FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627529_at:

>probe:Drosophila_2:1627529_at:95:557; Interrogation_Position=111; Antisense; GGACTGGAGGCTGCCGGTCATCATC
>probe:Drosophila_2:1627529_at:722:69; Interrogation_Position=118; Antisense; AGGCTGCCGGTCATCATCGCAACTT
>probe:Drosophila_2:1627529_at:198:239; Interrogation_Position=13; Antisense; AATCATTCCACATCAAGATGCGTTT
>probe:Drosophila_2:1627529_at:283:195; Interrogation_Position=238; Antisense; AACTGGCAAAATTTCCATTGACGGA
>probe:Drosophila_2:1627529_at:684:253; Interrogation_Position=244; Antisense; CAAAATTTCCATTGACGGACGATTT
>probe:Drosophila_2:1627529_at:692:549; Interrogation_Position=260; Antisense; GGACGATTTAAATGAAACCTACCAT
>probe:Drosophila_2:1627529_at:230:215; Interrogation_Position=27; Antisense; AAGATGCGTTTCTGTCTACTGTTCC
>probe:Drosophila_2:1627529_at:142:127; Interrogation_Position=280; Antisense; ACCATTATGTAATCCTATAGCTTCA
>probe:Drosophila_2:1627529_at:344:675; Interrogation_Position=346; Antisense; TAGTTCCAGTGTTTTAAACCACAGT
>probe:Drosophila_2:1627529_at:602:599; Interrogation_Position=39; Antisense; TGTCTACTGTTCCTTTTGGCCATGA
>probe:Drosophila_2:1627529_at:329:565; Interrogation_Position=405; Antisense; GGCAATATATCTATCTTATCTCGTT
>probe:Drosophila_2:1627529_at:159:703; Interrogation_Position=52; Antisense; TTTTGGCCATGAGCTGCTGTCTGCT
>probe:Drosophila_2:1627529_at:392:621; Interrogation_Position=66; Antisense; TGCTGTCTGCTGCAATTCTCCGTGG
>probe:Drosophila_2:1627529_at:249:247; Interrogation_Position=79; Antisense; AATTCTCCGTGGCTGGAGTGAATTT

Paste this into a BLAST search page for me
GGACTGGAGGCTGCCGGTCATCATCAGGCTGCCGGTCATCATCGCAACTTAATCATTCCACATCAAGATGCGTTTAACTGGCAAAATTTCCATTGACGGACAAAATTTCCATTGACGGACGATTTGGACGATTTAAATGAAACCTACCATAAGATGCGTTTCTGTCTACTGTTCCACCATTATGTAATCCTATAGCTTCATAGTTCCAGTGTTTTAAACCACAGTTGTCTACTGTTCCTTTTGGCCATGAGGCAATATATCTATCTTATCTCGTTTTTTGGCCATGAGCTGCTGTCTGCTTGCTGTCTGCTGCAATTCTCCGTGGAATTCTCCGTGGCTGGAGTGAATTT

Full Affymetrix probeset data:

Annotations for 1627529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720