Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627530_at:

>probe:Drosophila_2:1627530_at:103:473; Interrogation_Position=3943; Antisense; GTTCTGTCTCTCTATTGTATACCTG
>probe:Drosophila_2:1627530_at:386:687; Interrogation_Position=3972; Antisense; TATATACAACCATCAAATCCACCAC
>probe:Drosophila_2:1627530_at:189:309; Interrogation_Position=3999; Antisense; CCACGAACTACAACTGCAACGAGAT
>probe:Drosophila_2:1627530_at:289:359; Interrogation_Position=4014; Antisense; GCAACGAGATCCAGCCTGCATGCAA
>probe:Drosophila_2:1627530_at:668:315; Interrogation_Position=4027; Antisense; GCCTGCATGCAAAATTATCGGAAGT
>probe:Drosophila_2:1627530_at:508:483; Interrogation_Position=4071; Antisense; GTATGGCAAATTCAACCTGGTCTTC
>probe:Drosophila_2:1627530_at:675:291; Interrogation_Position=4098; Antisense; CGTCGCCACTAAACATCCGTGAAGG
>probe:Drosophila_2:1627530_at:426:371; Interrogation_Position=4118; Antisense; GAAGGCATTCAACAAGTCATCAAAT
>probe:Drosophila_2:1627530_at:523:355; Interrogation_Position=4145; Antisense; GCACGACATTTGTAAGCTCTTCCAA
>probe:Drosophila_2:1627530_at:330:339; Interrogation_Position=4160; Antisense; GCTCTTCCAATTTTAATTCGCTTTA
>probe:Drosophila_2:1627530_at:512:95; Interrogation_Position=4428; Antisense; AGATTTCAAAAGCTCCCCTATCTAT
>probe:Drosophila_2:1627530_at:529:117; Interrogation_Position=4438; Antisense; AGCTCCCCTATCTATGGATGCAAAC
>probe:Drosophila_2:1627530_at:595:227; Interrogation_Position=4463; Antisense; AATGGCATCCCGATTGCATGAAATG
>probe:Drosophila_2:1627530_at:478:433; Interrogation_Position=4489; Antisense; GAGTGCTATTATCCCGCTTTTAACA

Paste this into a BLAST search page for me
GTTCTGTCTCTCTATTGTATACCTGTATATACAACCATCAAATCCACCACCCACGAACTACAACTGCAACGAGATGCAACGAGATCCAGCCTGCATGCAAGCCTGCATGCAAAATTATCGGAAGTGTATGGCAAATTCAACCTGGTCTTCCGTCGCCACTAAACATCCGTGAAGGGAAGGCATTCAACAAGTCATCAAATGCACGACATTTGTAAGCTCTTCCAAGCTCTTCCAATTTTAATTCGCTTTAAGATTTCAAAAGCTCCCCTATCTATAGCTCCCCTATCTATGGATGCAAACAATGGCATCCCGATTGCATGAAATGGAGTGCTATTATCCCGCTTTTAACA

Full Affymetrix probeset data:

Annotations for 1627530_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime