Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627533_at:

>probe:Drosophila_2:1627533_at:624:351; Interrogation_Position=5831; Antisense; GCAGCAGCATCTAGCGACTAAATTA
>probe:Drosophila_2:1627533_at:257:263; Interrogation_Position=5935; Antisense; CAGCCGAAAGGATATCTCCTCCGAT
>probe:Drosophila_2:1627533_at:260:451; Interrogation_Position=5957; Antisense; GATCGGAACAGAACTCGCTAAGCTT
>probe:Drosophila_2:1627533_at:2:339; Interrogation_Position=5973; Antisense; GCTAAGCTTTAGACACCCCACATTT
>probe:Drosophila_2:1627533_at:477:309; Interrogation_Position=5990; Antisense; CCACATTTCCCCATGGTAGTGTAAT
>probe:Drosophila_2:1627533_at:284:539; Interrogation_Position=6004; Antisense; GGTAGTGTAATCAACTTGTGCCATT
>probe:Drosophila_2:1627533_at:412:729; Interrogation_Position=6019; Antisense; TTGTGCCATTCGAACTGCCTAGTAT
>probe:Drosophila_2:1627533_at:195:311; Interrogation_Position=6105; Antisense; CCACATCCCTACTCATTTTGTACAT
>probe:Drosophila_2:1627533_at:672:177; Interrogation_Position=6160; Antisense; AAACTATGCCAAGCTTGCAGGCCTC
>probe:Drosophila_2:1627533_at:183:349; Interrogation_Position=6176; Antisense; GCAGGCCTCTTTACCAGAACATTTT
>probe:Drosophila_2:1627533_at:687:147; Interrogation_Position=6194; Antisense; ACATTTTAGCCCGATCTCAAGTTTA
>probe:Drosophila_2:1627533_at:273:479; Interrogation_Position=6214; Antisense; GTTTAAACTCTTCTCACAGACACAA
>probe:Drosophila_2:1627533_at:108:79; Interrogation_Position=6248; Antisense; AGGATACAAACACACTCGCTGGCAG
>probe:Drosophila_2:1627533_at:437:333; Interrogation_Position=6265; Antisense; GCTGGCAGCCACAATTGTACTACAT

Paste this into a BLAST search page for me
GCAGCAGCATCTAGCGACTAAATTACAGCCGAAAGGATATCTCCTCCGATGATCGGAACAGAACTCGCTAAGCTTGCTAAGCTTTAGACACCCCACATTTCCACATTTCCCCATGGTAGTGTAATGGTAGTGTAATCAACTTGTGCCATTTTGTGCCATTCGAACTGCCTAGTATCCACATCCCTACTCATTTTGTACATAAACTATGCCAAGCTTGCAGGCCTCGCAGGCCTCTTTACCAGAACATTTTACATTTTAGCCCGATCTCAAGTTTAGTTTAAACTCTTCTCACAGACACAAAGGATACAAACACACTCGCTGGCAGGCTGGCAGCCACAATTGTACTACAT

Full Affymetrix probeset data:

Annotations for 1627533_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime