FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627536_at:

>probe:Drosophila_2:1627536_at:127:239; Interrogation_Position=231; Antisense; AATACCGTACCATGGCCATAGAGTC
>probe:Drosophila_2:1627536_at:333:25; Interrogation_Position=248; Antisense; ATAGAGTCACGCTCTACGAGCACTG
>probe:Drosophila_2:1627536_at:315:651; Interrogation_Position=302; Antisense; TCAACCACAAGCTCAAAATCTCCAG
>probe:Drosophila_2:1627536_at:635:491; Interrogation_Position=326; Antisense; GTAACATTCGGTAATCTCGGCGAGA
>probe:Drosophila_2:1627536_at:681:183; Interrogation_Position=350; Antisense; AAAAGACGCGCCGAACAGCTGTTCC
>probe:Drosophila_2:1627536_at:685:283; Interrogation_Position=401; Antisense; CTGCTCCTGACTTTAATGCTCGGAT
>probe:Drosophila_2:1627536_at:580:337; Interrogation_Position=418; Antisense; GCTCGGATTCGGCAAATGCTGCACT
>probe:Drosophila_2:1627536_at:490:567; Interrogation_Position=490; Antisense; GGCAGTTAGCCCACATAATCCACAA
>probe:Drosophila_2:1627536_at:449:565; Interrogation_Position=554; Antisense; GGCAAAGCCTTCATCAACATGGGAT
>probe:Drosophila_2:1627536_at:184:65; Interrogation_Position=572; Antisense; ATGGGATTCAAGTTCCTCAACGTTT
>probe:Drosophila_2:1627536_at:447:693; Interrogation_Position=594; Antisense; TTTCCGGAAAGATTGGCACACCCCT
>probe:Drosophila_2:1627536_at:332:403; Interrogation_Position=680; Antisense; GACTGCATACCCATTCGATTCGTTT
>probe:Drosophila_2:1627536_at:186:11; Interrogation_Position=692; Antisense; ATTCGATTCGTTTGCGACGGCGATG
>probe:Drosophila_2:1627536_at:19:575; Interrogation_Position=710; Antisense; GGCGATGCGGACTGCAAGGATCACA

Paste this into a BLAST search page for me
AATACCGTACCATGGCCATAGAGTCATAGAGTCACGCTCTACGAGCACTGTCAACCACAAGCTCAAAATCTCCAGGTAACATTCGGTAATCTCGGCGAGAAAAAGACGCGCCGAACAGCTGTTCCCTGCTCCTGACTTTAATGCTCGGATGCTCGGATTCGGCAAATGCTGCACTGGCAGTTAGCCCACATAATCCACAAGGCAAAGCCTTCATCAACATGGGATATGGGATTCAAGTTCCTCAACGTTTTTTCCGGAAAGATTGGCACACCCCTGACTGCATACCCATTCGATTCGTTTATTCGATTCGTTTGCGACGGCGATGGGCGATGCGGACTGCAAGGATCACA

Full Affymetrix probeset data:

Annotations for 1627536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720