Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627537_at:

>probe:Drosophila_2:1627537_at:335:129; Interrogation_Position=1105; Antisense; ACCTCGGAGAATGCGCTGCGTGACA
>probe:Drosophila_2:1627537_at:228:547; Interrogation_Position=1134; Antisense; GGATGCACTGAAGCTGGCCGAGACA
>probe:Drosophila_2:1627537_at:306:137; Interrogation_Position=1214; Antisense; ACGACATGCTCTGCTTGGAGGTGGA
>probe:Drosophila_2:1627537_at:107:457; Interrogation_Position=1251; Antisense; GATACGACGCCGACTGCAGGTCAAG
>probe:Drosophila_2:1627537_at:283:451; Interrogation_Position=1275; Antisense; GATCGACGAGAGCAAGACCAACTTT
>probe:Drosophila_2:1627537_at:527:351; Interrogation_Position=1350; Antisense; GCAGCACTCGCTGATGACGGACATC
>probe:Drosophila_2:1627537_at:259:561; Interrogation_Position=1451; Antisense; GGAACATAACGCTCACTCGCATGGA
>probe:Drosophila_2:1627537_at:483:249; Interrogation_Position=1492; Antisense; GACTAGACTTGGGACTATGCCGCTT
>probe:Drosophila_2:1627537_at:718:681; Interrogation_Position=1507; Antisense; TATGCCGCTTGCTCACTTATTCAAT
>probe:Drosophila_2:1627537_at:553:711; Interrogation_Position=1526; Antisense; TTCAATTCTATTTGCCCTGACGTTC
>probe:Drosophila_2:1627537_at:218:471; Interrogation_Position=1547; Antisense; GTTCGTTGCACGTTGTAATTTGTCC
>probe:Drosophila_2:1627537_at:704:659; Interrogation_Position=1598; Antisense; TAACGTTAAAGCTTCTTCTGGCCAA
>probe:Drosophila_2:1627537_at:614:279; Interrogation_Position=1625; Antisense; CTGAAGGTCAGTTCACCCAGCAGGG
>probe:Drosophila_2:1627537_at:418:613; Interrogation_Position=1653; Antisense; TGAAAACCGTGCTCCATTCTAGATG

Paste this into a BLAST search page for me
ACCTCGGAGAATGCGCTGCGTGACAGGATGCACTGAAGCTGGCCGAGACAACGACATGCTCTGCTTGGAGGTGGAGATACGACGCCGACTGCAGGTCAAGGATCGACGAGAGCAAGACCAACTTTGCAGCACTCGCTGATGACGGACATCGGAACATAACGCTCACTCGCATGGAGACTAGACTTGGGACTATGCCGCTTTATGCCGCTTGCTCACTTATTCAATTTCAATTCTATTTGCCCTGACGTTCGTTCGTTGCACGTTGTAATTTGTCCTAACGTTAAAGCTTCTTCTGGCCAACTGAAGGTCAGTTCACCCAGCAGGGTGAAAACCGTGCTCCATTCTAGATG

Full Affymetrix probeset data:

Annotations for 1627537_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime