FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627538_at:

>probe:Drosophila_2:1627538_at:237:277; Interrogation_Position=170; Antisense; CTACAACTTCGACCATGACAAGCAC
>probe:Drosophila_2:1627538_at:208:55; Interrogation_Position=184; Antisense; ATGACAAGCACATCTTCTCTGGACA
>probe:Drosophila_2:1627538_at:554:713; Interrogation_Position=198; Antisense; TTCTCTGGACACAGCGGCAAGCAGC
>probe:Drosophila_2:1627538_at:192:353; Interrogation_Position=218; Antisense; GCAGCGCAACAAGAGGGAGGCCAAT
>probe:Drosophila_2:1627538_at:369:529; Interrogation_Position=232; Antisense; GGGAGGCCAATGAGCACACCAACCA
>probe:Drosophila_2:1627538_at:369:9; Interrogation_Position=274; Antisense; ATTCCCGCAAGATTCTGACCAAGCT
>probe:Drosophila_2:1627538_at:119:321; Interrogation_Position=327; Antisense; GCCGCCGCCTGCAAGAACTGATGCA
>probe:Drosophila_2:1627538_at:147:273; Interrogation_Position=534; Antisense; CATTTGTATTGTGCATTGGCTTTTC
>probe:Drosophila_2:1627538_at:289:3; Interrogation_Position=548; Antisense; ATTGGCTTTTCATGCGGCGCTAAAC
>probe:Drosophila_2:1627538_at:539:331; Interrogation_Position=561; Antisense; GCGGCGCTAAACTTTGTGAACATTA
>probe:Drosophila_2:1627538_at:495:567; Interrogation_Position=632; Antisense; GGCACATACTACTCTTAGCTTCTAA
>probe:Drosophila_2:1627538_at:704:7; Interrogation_Position=660; Antisense; ATTCCTAAACTAATTCAGACTTGCA
>probe:Drosophila_2:1627538_at:105:359; Interrogation_Position=682; Antisense; GCAAGTTTTAGTTGCTAAGCCTTAG
>probe:Drosophila_2:1627538_at:690:173; Interrogation_Position=696; Antisense; CTAAGCCTTAGAGCGTTTCAAATAA

Paste this into a BLAST search page for me
CTACAACTTCGACCATGACAAGCACATGACAAGCACATCTTCTCTGGACATTCTCTGGACACAGCGGCAAGCAGCGCAGCGCAACAAGAGGGAGGCCAATGGGAGGCCAATGAGCACACCAACCAATTCCCGCAAGATTCTGACCAAGCTGCCGCCGCCTGCAAGAACTGATGCACATTTGTATTGTGCATTGGCTTTTCATTGGCTTTTCATGCGGCGCTAAACGCGGCGCTAAACTTTGTGAACATTAGGCACATACTACTCTTAGCTTCTAAATTCCTAAACTAATTCAGACTTGCAGCAAGTTTTAGTTGCTAAGCCTTAGCTAAGCCTTAGAGCGTTTCAAATAA

Full Affymetrix probeset data:

Annotations for 1627538_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720