FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627539_at:

>probe:Drosophila_2:1627539_at:113:221; Interrogation_Position=1009; Antisense; AAGTGCTGCCAGTCTATGACGAAGC
>probe:Drosophila_2:1627539_at:668:519; Interrogation_Position=1035; Antisense; GTGGAGACCTCGACATTGGCTCAAA
>probe:Drosophila_2:1627539_at:335:181; Interrogation_Position=1057; Antisense; AAAAGTTGGCCGTCGCTAATGCAAA
>probe:Drosophila_2:1627539_at:298:503; Interrogation_Position=1087; Antisense; GTCGCTTTGGTGAGGATCCGCATGA
>probe:Drosophila_2:1627539_at:452:227; Interrogation_Position=1123; Antisense; AAGGCGATTCGCTGTGCCCACAGAA
>probe:Drosophila_2:1627539_at:461:95; Interrogation_Position=1228; Antisense; AGATTCCACCTACGATTTTCTCAAG
>probe:Drosophila_2:1627539_at:2:59; Interrogation_Position=1256; Antisense; ATGATTGACAACACACTCTGGAGTA
>probe:Drosophila_2:1627539_at:534:633; Interrogation_Position=734; Antisense; TCGCTGCGACGTCAATCATATGGGC
>probe:Drosophila_2:1627539_at:267:65; Interrogation_Position=753; Antisense; ATGGGCATCCATTCGGGCAACAGCA
>probe:Drosophila_2:1627539_at:49:189; Interrogation_Position=771; Antisense; AACAGCAGTTTGTCCAGTGCCAATG
>probe:Drosophila_2:1627539_at:194:667; Interrogation_Position=805; Antisense; TACACCAAATGTTCCAGCAGAGCCT
>probe:Drosophila_2:1627539_at:658:631; Interrogation_Position=885; Antisense; TCGCCTACTAATTCCCTATATCAAG
>probe:Drosophila_2:1627539_at:329:685; Interrogation_Position=901; Antisense; TATATCAAGGTCTACCGGCCGAAAT
>probe:Drosophila_2:1627539_at:40:217; Interrogation_Position=975; Antisense; AAGTTGGGCCTATTGCTCCCGAATC

Paste this into a BLAST search page for me
AAGTGCTGCCAGTCTATGACGAAGCGTGGAGACCTCGACATTGGCTCAAAAAAAGTTGGCCGTCGCTAATGCAAAGTCGCTTTGGTGAGGATCCGCATGAAAGGCGATTCGCTGTGCCCACAGAAAGATTCCACCTACGATTTTCTCAAGATGATTGACAACACACTCTGGAGTATCGCTGCGACGTCAATCATATGGGCATGGGCATCCATTCGGGCAACAGCAAACAGCAGTTTGTCCAGTGCCAATGTACACCAAATGTTCCAGCAGAGCCTTCGCCTACTAATTCCCTATATCAAGTATATCAAGGTCTACCGGCCGAAATAAGTTGGGCCTATTGCTCCCGAATC

Full Affymetrix probeset data:

Annotations for 1627539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720