Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627541_at:

>probe:Drosophila_2:1627541_at:102:429; Interrogation_Position=1313; Antisense; GAGTAACCAAGGAGCACTCGCAGTT
>probe:Drosophila_2:1627541_at:275:109; Interrogation_Position=1361; Antisense; AGAAGCTGCATTACGCCAACGAGGA
>probe:Drosophila_2:1627541_at:404:593; Interrogation_Position=1391; Antisense; TGGGCAGACCCAAACTTGAGTCCTG
>probe:Drosophila_2:1627541_at:535:431; Interrogation_Position=1408; Antisense; GAGTCCTGCAAGATTATACCGCCGA
>probe:Drosophila_2:1627541_at:643:435; Interrogation_Position=1552; Antisense; GAGGATTCTGATGATTCGGGACACA
>probe:Drosophila_2:1627541_at:350:717; Interrogation_Position=1566; Antisense; TTCGGGACACATAAGCAACACACAG
>probe:Drosophila_2:1627541_at:147:193; Interrogation_Position=1609; Antisense; AACTCCACCGGTAGCCTTTGTGAAT
>probe:Drosophila_2:1627541_at:691:649; Interrogation_Position=1656; Antisense; TCAACCGCCGGATGCAAAAAGCTGT
>probe:Drosophila_2:1627541_at:96:597; Interrogation_Position=1678; Antisense; TGTACCAAATCCAACAAGATCGCGG
>probe:Drosophila_2:1627541_at:298:97; Interrogation_Position=1694; Antisense; AGATCGCGGAGCTTTTACAGAAATT
>probe:Drosophila_2:1627541_at:504:181; Interrogation_Position=1742; Antisense; AAAAAAGTGCCACCGCCACGATGCA
>probe:Drosophila_2:1627541_at:388:253; Interrogation_Position=1807; Antisense; CAAGCTGTGAGCTGCATTCAGACAC
>probe:Drosophila_2:1627541_at:342:453; Interrogation_Position=1839; Antisense; GATCTATCCCACCTACACGAAAGAG
>probe:Drosophila_2:1627541_at:537:169; Interrogation_Position=1858; Antisense; AAAGAGGTAACTATGCGGCTGCACT

Paste this into a BLAST search page for me
GAGTAACCAAGGAGCACTCGCAGTTAGAAGCTGCATTACGCCAACGAGGATGGGCAGACCCAAACTTGAGTCCTGGAGTCCTGCAAGATTATACCGCCGAGAGGATTCTGATGATTCGGGACACATTCGGGACACATAAGCAACACACAGAACTCCACCGGTAGCCTTTGTGAATTCAACCGCCGGATGCAAAAAGCTGTTGTACCAAATCCAACAAGATCGCGGAGATCGCGGAGCTTTTACAGAAATTAAAAAAGTGCCACCGCCACGATGCACAAGCTGTGAGCTGCATTCAGACACGATCTATCCCACCTACACGAAAGAGAAAGAGGTAACTATGCGGCTGCACT

Full Affymetrix probeset data:

Annotations for 1627541_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime