FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627542_at:

>probe:Drosophila_2:1627542_at:276:551; Interrogation_Position=349; Antisense; GGAGAACGACGTGGCTGTCCTCAAA
>probe:Drosophila_2:1627542_at:358:597; Interrogation_Position=364; Antisense; TGTCCTCAAACTGAGCAGTCCTTTA
>probe:Drosophila_2:1627542_at:59:31; Interrogation_Position=404; Antisense; ATACAAACAATTCCCTTGGCCGAGA
>probe:Drosophila_2:1627542_at:118:717; Interrogation_Position=489; Antisense; TTCGACCACGACAACTTCAGGGAGT
>probe:Drosophila_2:1627542_at:403:427; Interrogation_Position=510; Antisense; GAGTTGAAATCCTTATTCGGCCGCT
>probe:Drosophila_2:1627542_at:653:11; Interrogation_Position=524; Antisense; ATTCGGCCGCTGATCGTGTGTAAAT
>probe:Drosophila_2:1627542_at:227:711; Interrogation_Position=569; Antisense; TTCAATGAGGACATCTGCGCGGGAA
>probe:Drosophila_2:1627542_at:640:271; Interrogation_Position=634; Antisense; CTTGGTCTTCAACGGCCAGCTAGTG
>probe:Drosophila_2:1627542_at:68:191; Interrogation_Position=680; Antisense; AACATTGTTTGCTTGGGATCTTCTC
>probe:Drosophila_2:1627542_at:305:453; Interrogation_Position=696; Antisense; GATCTTCTCTGTACGCTAGTGTGGC
>probe:Drosophila_2:1627542_at:178:577; Interrogation_Position=718; Antisense; GGCGCGTTATCGTAACTGGATCCTT
>probe:Drosophila_2:1627542_at:490:589; Interrogation_Position=734; Antisense; TGGATCCTTAGTGCCATCGATGTAT
>probe:Drosophila_2:1627542_at:328:481; Interrogation_Position=755; Antisense; GTATTGCATTTTCAAGCACCCGCTA
>probe:Drosophila_2:1627542_at:134:401; Interrogation_Position=796; Antisense; GACATTCCAACTTAACGTTCGCAGC

Paste this into a BLAST search page for me
GGAGAACGACGTGGCTGTCCTCAAATGTCCTCAAACTGAGCAGTCCTTTAATACAAACAATTCCCTTGGCCGAGATTCGACCACGACAACTTCAGGGAGTGAGTTGAAATCCTTATTCGGCCGCTATTCGGCCGCTGATCGTGTGTAAATTTCAATGAGGACATCTGCGCGGGAACTTGGTCTTCAACGGCCAGCTAGTGAACATTGTTTGCTTGGGATCTTCTCGATCTTCTCTGTACGCTAGTGTGGCGGCGCGTTATCGTAACTGGATCCTTTGGATCCTTAGTGCCATCGATGTATGTATTGCATTTTCAAGCACCCGCTAGACATTCCAACTTAACGTTCGCAGC

Full Affymetrix probeset data:

Annotations for 1627542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720