Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627543_at:

>probe:Drosophila_2:1627543_at:724:309; Interrogation_Position=483; Antisense; CCACAGAAACGAGGTGGCAGTGGCA
>probe:Drosophila_2:1627543_at:405:149; Interrogation_Position=781; Antisense; ACTTGCAGGTGGGTGTGGCCGGCCA
>probe:Drosophila_2:1627543_at:165:289; Interrogation_Position=800; Antisense; CGGCCAGTGGCCGACTCTTGATTTA
>probe:Drosophila_2:1627543_at:261:309; Interrogation_Position=803; Antisense; CCAGTGGCCGACTCTTGATTTATTG
>probe:Drosophila_2:1627543_at:564:521; Interrogation_Position=806; Antisense; GTGGCCGACTCTTGATTTATTGGCG
>probe:Drosophila_2:1627543_at:675:295; Interrogation_Position=811; Antisense; CGACTCTTGATTTATTGGCGCCGCA
>probe:Drosophila_2:1627543_at:652:143; Interrogation_Position=813; Antisense; ACTCTTGATTTATTGGCGCCGCATG
>probe:Drosophila_2:1627543_at:78:647; Interrogation_Position=815; Antisense; TCTTGATTTATTGGCGCCGCATGTG
>probe:Drosophila_2:1627543_at:257:3; Interrogation_Position=824; Antisense; ATTGGCGCCGCATGTGTCGCGGCTA
>probe:Drosophila_2:1627543_at:236:299; Interrogation_Position=829; Antisense; CGCCGCATGTGTCGCGGCTAATTTA
>probe:Drosophila_2:1627543_at:558:61; Interrogation_Position=835; Antisense; ATGTGTCGCGGCTAATTTATATCGT
>probe:Drosophila_2:1627543_at:197:515; Interrogation_Position=837; Antisense; GTGTCGCGGCTAATTTATATCGTGG
>probe:Drosophila_2:1627543_at:356:635; Interrogation_Position=840; Antisense; TCGCGGCTAATTTATATCGTGGGCT
>probe:Drosophila_2:1627543_at:50:329; Interrogation_Position=842; Antisense; GCGGCTAATTTATATCGTGGGCTAA

Paste this into a BLAST search page for me
CCACAGAAACGAGGTGGCAGTGGCAACTTGCAGGTGGGTGTGGCCGGCCACGGCCAGTGGCCGACTCTTGATTTACCAGTGGCCGACTCTTGATTTATTGGTGGCCGACTCTTGATTTATTGGCGCGACTCTTGATTTATTGGCGCCGCAACTCTTGATTTATTGGCGCCGCATGTCTTGATTTATTGGCGCCGCATGTGATTGGCGCCGCATGTGTCGCGGCTACGCCGCATGTGTCGCGGCTAATTTAATGTGTCGCGGCTAATTTATATCGTGTGTCGCGGCTAATTTATATCGTGGTCGCGGCTAATTTATATCGTGGGCTGCGGCTAATTTATATCGTGGGCTAA

Full Affymetrix probeset data:

Annotations for 1627543_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime