FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627544_at:

>probe:Drosophila_2:1627544_at:414:277; Interrogation_Position=140; Antisense; CTAACTTCCAGGTGGACGAGCTGCT
>probe:Drosophila_2:1627544_at:579:119; Interrogation_Position=158; Antisense; AGCTGCTGCTGTTAAAGAAGTCCGT
>probe:Drosophila_2:1627544_at:446:455; Interrogation_Position=202; Antisense; GATAAGAACGATAGTCTCCAGCCGA
>probe:Drosophila_2:1627544_at:489:125; Interrogation_Position=221; Antisense; AGCCGACTACGGAATGCCCACAGAT
>probe:Drosophila_2:1627544_at:209:51; Interrogation_Position=234; Antisense; ATGCCCACAGATGGCGCCGGATGGA
>probe:Drosophila_2:1627544_at:533:441; Interrogation_Position=253; Antisense; GATGGATCGCCACTGCCAGAGCGAA
>probe:Drosophila_2:1627544_at:318:325; Interrogation_Position=273; Antisense; GCGAATGGCCTTGATGGCCGCAGAT
>probe:Drosophila_2:1627544_at:511:255; Interrogation_Position=383; Antisense; CAAAGTTGCAGACCCTATTCCAGAT
>probe:Drosophila_2:1627544_at:338:685; Interrogation_Position=398; Antisense; TATTCCAGATCAGCATTACGGCCCT
>probe:Drosophila_2:1627544_at:680:685; Interrogation_Position=445; Antisense; TATCTACTCTGCCTAATCGTGCAGG
>probe:Drosophila_2:1627544_at:558:199; Interrogation_Position=545; Antisense; AACGCATCAAGATATACCGCCGCAG
>probe:Drosophila_2:1627544_at:116:671; Interrogation_Position=625; Antisense; TACGCCTCCTACATGAAATCTTTGC
>probe:Drosophila_2:1627544_at:318:165; Interrogation_Position=640; Antisense; AAATCTTTGCGAGATCGCGGCTGGG
>probe:Drosophila_2:1627544_at:64:405; Interrogation_Position=90; Antisense; GACTACATGCAGTGTGACCAGCACA

Paste this into a BLAST search page for me
CTAACTTCCAGGTGGACGAGCTGCTAGCTGCTGCTGTTAAAGAAGTCCGTGATAAGAACGATAGTCTCCAGCCGAAGCCGACTACGGAATGCCCACAGATATGCCCACAGATGGCGCCGGATGGAGATGGATCGCCACTGCCAGAGCGAAGCGAATGGCCTTGATGGCCGCAGATCAAAGTTGCAGACCCTATTCCAGATTATTCCAGATCAGCATTACGGCCCTTATCTACTCTGCCTAATCGTGCAGGAACGCATCAAGATATACCGCCGCAGTACGCCTCCTACATGAAATCTTTGCAAATCTTTGCGAGATCGCGGCTGGGGACTACATGCAGTGTGACCAGCACA

Full Affymetrix probeset data:

Annotations for 1627544_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720