FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627545_at:

>probe:Drosophila_2:1627545_at:32:133; Interrogation_Position=151; Antisense; ACCGTGCGCGCCCTGAAAATGCAAG
>probe:Drosophila_2:1627545_at:30:271; Interrogation_Position=183; Antisense; CATGCTGATCATAAACCCCAAGGGA
>probe:Drosophila_2:1627545_at:550:701; Interrogation_Position=215; Antisense; TTTTCGAGGAGCTAGCGGTGGCCAT
>probe:Drosophila_2:1627545_at:497:233; Interrogation_Position=282; Antisense; AATCCTGGGCGGACACGGGCAGACC
>probe:Drosophila_2:1627545_at:651:525; Interrogation_Position=298; Antisense; GGGCAGACCGACTCATCTGTTCTGG
>probe:Drosophila_2:1627545_at:519:471; Interrogation_Position=316; Antisense; GTTCTGGCCGCCAAATTGAGTAAAC
>probe:Drosophila_2:1627545_at:712:725; Interrogation_Position=331; Antisense; TTGAGTAAACGCTACTGCCGCCAGT
>probe:Drosophila_2:1627545_at:388:311; Interrogation_Position=350; Antisense; GCCAGTTCTACGTGAGCCTTAATCT
>probe:Drosophila_2:1627545_at:559:141; Interrogation_Position=378; Antisense; ACTGGATCGATTAATGGGCCCTCTG
>probe:Drosophila_2:1627545_at:138:629; Interrogation_Position=389; Antisense; TAATGGGCCCTCTGTTCGAGAAGAC
>probe:Drosophila_2:1627545_at:93:213; Interrogation_Position=409; Antisense; AAGACGCTAGTCACCTACATGCAAG
>probe:Drosophila_2:1627545_at:303:41; Interrogation_Position=437; Antisense; ATCTGGAGCACTTCGCTTGAGTGGG
>probe:Drosophila_2:1627545_at:20:119; Interrogation_Position=569; Antisense; AGCTAACTATCTGGGATCTCCGATT
>probe:Drosophila_2:1627545_at:6:575; Interrogation_Position=619; Antisense; GGCGGCCGAGTGAGCACGAACTTTA

Paste this into a BLAST search page for me
ACCGTGCGCGCCCTGAAAATGCAAGCATGCTGATCATAAACCCCAAGGGATTTTCGAGGAGCTAGCGGTGGCCATAATCCTGGGCGGACACGGGCAGACCGGGCAGACCGACTCATCTGTTCTGGGTTCTGGCCGCCAAATTGAGTAAACTTGAGTAAACGCTACTGCCGCCAGTGCCAGTTCTACGTGAGCCTTAATCTACTGGATCGATTAATGGGCCCTCTGTAATGGGCCCTCTGTTCGAGAAGACAAGACGCTAGTCACCTACATGCAAGATCTGGAGCACTTCGCTTGAGTGGGAGCTAACTATCTGGGATCTCCGATTGGCGGCCGAGTGAGCACGAACTTTA

Full Affymetrix probeset data:

Annotations for 1627545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720