Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627546_at:

>probe:Drosophila_2:1627546_at:690:525; Interrogation_Position=2305; Antisense; GGGCACCAAGACGTTCCACATCAAG
>probe:Drosophila_2:1627546_at:129:435; Interrogation_Position=2330; Antisense; GAGGAGCCGGACAACTCGGACTTCA
>probe:Drosophila_2:1627546_at:181:639; Interrogation_Position=2345; Antisense; TCGGACTTCACCGTGGAATGGCAAG
>probe:Drosophila_2:1627546_at:722:535; Interrogation_Position=2383; Antisense; GGTAATGGTCGTAGAGCTGGTTAAT
>probe:Drosophila_2:1627546_at:703:603; Interrogation_Position=2421; Antisense; TGTTGGTCAAGCACGAACCGAGCGC
>probe:Drosophila_2:1627546_at:102:313; Interrogation_Position=2444; Antisense; GCCAACTCCAAGATCAGTGCCAAAA
>probe:Drosophila_2:1627546_at:170:193; Interrogation_Position=2468; Antisense; AACTGCTTTGGTTTCGAGGACGACG
>probe:Drosophila_2:1627546_at:168:183; Interrogation_Position=2520; Antisense; AAAACGAGGTCGATGGCGCTTCCCA
>probe:Drosophila_2:1627546_at:268:719; Interrogation_Position=2539; Antisense; TTCCCAGGAGTTTCTGCAGCTGATG
>probe:Drosophila_2:1627546_at:572:461; Interrogation_Position=2569; Antisense; GATTGAGCAGGACTCTTAGTCTCCT
>probe:Drosophila_2:1627546_at:96:483; Interrogation_Position=2658; Antisense; GTATTTCTACGTTACATTGTTTTCT
>probe:Drosophila_2:1627546_at:233:473; Interrogation_Position=2789; Antisense; GTTAACATGCCGATATGGCGACTAT
>probe:Drosophila_2:1627546_at:431:575; Interrogation_Position=2805; Antisense; GGCGACTATTTGTAAATGATCCCCG
>probe:Drosophila_2:1627546_at:602:1; Interrogation_Position=2820; Antisense; ATGATCCCCGACACTTAAACTTTAG

Paste this into a BLAST search page for me
GGGCACCAAGACGTTCCACATCAAGGAGGAGCCGGACAACTCGGACTTCATCGGACTTCACCGTGGAATGGCAAGGGTAATGGTCGTAGAGCTGGTTAATTGTTGGTCAAGCACGAACCGAGCGCGCCAACTCCAAGATCAGTGCCAAAAAACTGCTTTGGTTTCGAGGACGACGAAAACGAGGTCGATGGCGCTTCCCATTCCCAGGAGTTTCTGCAGCTGATGGATTGAGCAGGACTCTTAGTCTCCTGTATTTCTACGTTACATTGTTTTCTGTTAACATGCCGATATGGCGACTATGGCGACTATTTGTAAATGATCCCCGATGATCCCCGACACTTAAACTTTAG

Full Affymetrix probeset data:

Annotations for 1627546_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime