Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627547_at:

>probe:Drosophila_2:1627547_at:718:7; Interrogation_Position=102; Antisense; ATTCGCAAGTTCCTTCACAACAAAC
>probe:Drosophila_2:1627547_at:99:459; Interrogation_Position=150; Antisense; GATTTGCGCAACGTAATGCCCTGGG
>probe:Drosophila_2:1627547_at:396:501; Interrogation_Position=175; Antisense; GTCGCAGCCATTGGAGTCACACGGA
>probe:Drosophila_2:1627547_at:531:157; Interrogation_Position=193; Antisense; ACACGGACCTCACGCGACTGAAGAA
>probe:Drosophila_2:1627547_at:689:137; Interrogation_Position=245; Antisense; ACGAGGCACGAAGGACGCTCTTGGA
>probe:Drosophila_2:1627547_at:436:83; Interrogation_Position=275; Antisense; AGTGGCCGCAACGAGTAGTCGCCGA
>probe:Drosophila_2:1627547_at:625:327; Interrogation_Position=29; Antisense; GCGTTTGCGAGTGGCAGTTCAGCTT
>probe:Drosophila_2:1627547_at:139:139; Interrogation_Position=299; Antisense; ACGAGGCTGTAATCTGGGCCAGGAC
>probe:Drosophila_2:1627547_at:226:75; Interrogation_Position=319; Antisense; AGGACATTCAGGACATTCGGAGCAT
>probe:Drosophila_2:1627547_at:206:371; Interrogation_Position=378; Antisense; GAAGGCTTGGTCTCACCAGTTTTCA
>probe:Drosophila_2:1627547_at:649:91; Interrogation_Position=395; Antisense; AGTTTTCAGCCTCTTCTCATATCAT
>probe:Drosophila_2:1627547_at:243:713; Interrogation_Position=46; Antisense; TTCAGCTTCTGGATCAAGTGCCTTT
>probe:Drosophila_2:1627547_at:709:199; Interrogation_Position=61; Antisense; AAGTGCCTTTAATCGACGGGCATAA
>probe:Drosophila_2:1627547_at:140:141; Interrogation_Position=76; Antisense; ACGGGCATAACGACCTACCATGGAA

Paste this into a BLAST search page for me
ATTCGCAAGTTCCTTCACAACAAACGATTTGCGCAACGTAATGCCCTGGGGTCGCAGCCATTGGAGTCACACGGAACACGGACCTCACGCGACTGAAGAAACGAGGCACGAAGGACGCTCTTGGAAGTGGCCGCAACGAGTAGTCGCCGAGCGTTTGCGAGTGGCAGTTCAGCTTACGAGGCTGTAATCTGGGCCAGGACAGGACATTCAGGACATTCGGAGCATGAAGGCTTGGTCTCACCAGTTTTCAAGTTTTCAGCCTCTTCTCATATCATTTCAGCTTCTGGATCAAGTGCCTTTAAGTGCCTTTAATCGACGGGCATAAACGGGCATAACGACCTACCATGGAA

Full Affymetrix probeset data:

Annotations for 1627547_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime