Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627551_s_at:

>probe:Drosophila_2:1627551_s_at:106:701; Interrogation_Position=220; Antisense; TTTTCGCCGCCGGAAACACTCAAAG
>probe:Drosophila_2:1627551_s_at:478:159; Interrogation_Position=255; Antisense; ACAACTGGCGGAACTTTGGCCTACA
>probe:Drosophila_2:1627551_s_at:74:187; Interrogation_Position=279; Antisense; AACAATGCTGGTCATGGTGCCTCTT
>probe:Drosophila_2:1627551_s_at:355:535; Interrogation_Position=294; Antisense; GGTGCCTCTTTGACCAAAACACACA
>probe:Drosophila_2:1627551_s_at:714:257; Interrogation_Position=313; Antisense; CACACACGCCCGGAGTGAAGGATGT
>probe:Drosophila_2:1627551_s_at:36:439; Interrogation_Position=348; Antisense; GAGGCCCATGCCAATTTATTCAACA
>probe:Drosophila_2:1627551_s_at:371:41; Interrogation_Position=385; Antisense; ATCTGGATGCCAAGGTCTTTGCTTC
>probe:Drosophila_2:1627551_s_at:328:415; Interrogation_Position=451; Antisense; GAGCTGGTCTGGATTACTCCCACAT
>probe:Drosophila_2:1627551_s_at:679:667; Interrogation_Position=465; Antisense; TACTCCCACATCAACGGACATGGTG
>probe:Drosophila_2:1627551_s_at:178:611; Interrogation_Position=496; Antisense; TGACGCACAGCAACTTCCCAGGAAT
>probe:Drosophila_2:1627551_s_at:392:365; Interrogation_Position=517; Antisense; GAATCGGCCAGCAACTCGGCCTGGA
>probe:Drosophila_2:1627551_s_at:162:557; Interrogation_Position=543; Antisense; GGACGTGCTAATCTCTGGTCATCGC
>probe:Drosophila_2:1627551_s_at:220:591; Interrogation_Position=558; Antisense; TGGTCATCGCCCAATCGTGCTACTA
>probe:Drosophila_2:1627551_s_at:419:379; Interrogation_Position=638; Antisense; GAAGCCAAACTTTGGTGCTGGCCTG

Paste this into a BLAST search page for me
TTTTCGCCGCCGGAAACACTCAAAGACAACTGGCGGAACTTTGGCCTACAAACAATGCTGGTCATGGTGCCTCTTGGTGCCTCTTTGACCAAAACACACACACACACGCCCGGAGTGAAGGATGTGAGGCCCATGCCAATTTATTCAACAATCTGGATGCCAAGGTCTTTGCTTCGAGCTGGTCTGGATTACTCCCACATTACTCCCACATCAACGGACATGGTGTGACGCACAGCAACTTCCCAGGAATGAATCGGCCAGCAACTCGGCCTGGAGGACGTGCTAATCTCTGGTCATCGCTGGTCATCGCCCAATCGTGCTACTAGAAGCCAAACTTTGGTGCTGGCCTG

Full Affymetrix probeset data:

Annotations for 1627551_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime