FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627553_at:

>probe:Drosophila_2:1627553_at:382:321; Interrogation_Position=313; Antisense; GCCCGAGCAGAAGGTCAGCGTTGAC
>probe:Drosophila_2:1627553_at:94:123; Interrogation_Position=329; Antisense; AGCGTTGACATATTCATGCAGCCAA
>probe:Drosophila_2:1627553_at:154:207; Interrogation_Position=374; Antisense; AAGCGTCATAAGTTCCTTCTCCTGG
>probe:Drosophila_2:1627553_at:140:321; Interrogation_Position=398; Antisense; GCCGCCGAGGTGACTGGTGACATAA
>probe:Drosophila_2:1627553_at:709:167; Interrogation_Position=482; Antisense; AAATGTGAGCTAGTCCCTTCGAAGG
>probe:Drosophila_2:1627553_at:520:435; Interrogation_Position=528; Antisense; GAGGTTCAGCTGTAATATCCACGGA
>probe:Drosophila_2:1627553_at:465:551; Interrogation_Position=563; Antisense; GGAGAGGTCCATTTTGATGCCCAGG
>probe:Drosophila_2:1627553_at:566:447; Interrogation_Position=578; Antisense; GATGCCCAGGAAGTCAGTGAGCCAA
>probe:Drosophila_2:1627553_at:238:75; Interrogation_Position=636; Antisense; AGGACGAGCATATGGCCCTCACAGA
>probe:Drosophila_2:1627553_at:410:155; Interrogation_Position=656; Antisense; ACAGACCAGATCGACGGCTTGCGTG
>probe:Drosophila_2:1627553_at:443:3; Interrogation_Position=689; Antisense; ATTGGGCGCACTTTCTTCTACATGG
>probe:Drosophila_2:1627553_at:299:153; Interrogation_Position=708; Antisense; ACATGGCCGCCATAGTAATCATTAT
>probe:Drosophila_2:1627553_at:567:655; Interrogation_Position=723; Antisense; TAATCATTATACTGTCCGCTGTCGC
>probe:Drosophila_2:1627553_at:101:599; Interrogation_Position=742; Antisense; TGTCGCAGGCGCCTATTATGGCAAG

Paste this into a BLAST search page for me
GCCCGAGCAGAAGGTCAGCGTTGACAGCGTTGACATATTCATGCAGCCAAAAGCGTCATAAGTTCCTTCTCCTGGGCCGCCGAGGTGACTGGTGACATAAAAATGTGAGCTAGTCCCTTCGAAGGGAGGTTCAGCTGTAATATCCACGGAGGAGAGGTCCATTTTGATGCCCAGGGATGCCCAGGAAGTCAGTGAGCCAAAGGACGAGCATATGGCCCTCACAGAACAGACCAGATCGACGGCTTGCGTGATTGGGCGCACTTTCTTCTACATGGACATGGCCGCCATAGTAATCATTATTAATCATTATACTGTCCGCTGTCGCTGTCGCAGGCGCCTATTATGGCAAG

Full Affymetrix probeset data:

Annotations for 1627553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720