Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627557_a_at:

>probe:Drosophila_2:1627557_a_at:699:191; Interrogation_Position=1027; Antisense; AACTCGAAGTTGGTCTGCGGTTCAA
>probe:Drosophila_2:1627557_a_at:594:523; Interrogation_Position=1054; Antisense; GGGCAATGTGTACTTCAACCAGGAA
>probe:Drosophila_2:1627557_a_at:427:667; Interrogation_Position=1126; Antisense; TACTTTGGGTTTCGTGCTTGATGCA
>probe:Drosophila_2:1627557_a_at:439:125; Interrogation_Position=1177; Antisense; AGCCGAAGGCTCCTATTTTGGTACA
>probe:Drosophila_2:1627557_a_at:336:259; Interrogation_Position=1212; Antisense; CAGAACATTTCGCTGACTACTTAAT
>probe:Drosophila_2:1627557_a_at:479:99; Interrogation_Position=809; Antisense; AGAGAGTTCGTGATTTGCCTTTTTC
>probe:Drosophila_2:1627557_a_at:85:415; Interrogation_Position=834; Antisense; GACCAGCCAGCACTTTGATTTCGAT
>probe:Drosophila_2:1627557_a_at:32:605; Interrogation_Position=849; Antisense; TGATTTCGATTTCCAGATTCGCTGG
>probe:Drosophila_2:1627557_a_at:650:461; Interrogation_Position=864; Antisense; GATTCGCTGGCACCGCAATTAAATT
>probe:Drosophila_2:1627557_a_at:396:665; Interrogation_Position=883; Antisense; TAAATTCGCCTACAGACGTCGTCTA
>probe:Drosophila_2:1627557_a_at:290:139; Interrogation_Position=898; Antisense; ACGTCGTCTAGTGCCAGATGCCAAA
>probe:Drosophila_2:1627557_a_at:125:171; Interrogation_Position=920; Antisense; AAAGTTGCATTCTGCGGCCTAAGGA
>probe:Drosophila_2:1627557_a_at:391:225; Interrogation_Position=940; Antisense; AAGGACGAGTCTGATTCCCAGTCAC
>probe:Drosophila_2:1627557_a_at:270:301; Interrogation_Position=956; Antisense; CCCAGTCACGGCCTAATTTGATGAA

Paste this into a BLAST search page for me
AACTCGAAGTTGGTCTGCGGTTCAAGGGCAATGTGTACTTCAACCAGGAATACTTTGGGTTTCGTGCTTGATGCAAGCCGAAGGCTCCTATTTTGGTACACAGAACATTTCGCTGACTACTTAATAGAGAGTTCGTGATTTGCCTTTTTCGACCAGCCAGCACTTTGATTTCGATTGATTTCGATTTCCAGATTCGCTGGGATTCGCTGGCACCGCAATTAAATTTAAATTCGCCTACAGACGTCGTCTAACGTCGTCTAGTGCCAGATGCCAAAAAAGTTGCATTCTGCGGCCTAAGGAAAGGACGAGTCTGATTCCCAGTCACCCCAGTCACGGCCTAATTTGATGAA

Full Affymetrix probeset data:

Annotations for 1627557_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime