Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627558_at:

>probe:Drosophila_2:1627558_at:510:625; Interrogation_Position=2187; Antisense; TGCCAACTCCAGCAGTGACTTTAAG
>probe:Drosophila_2:1627558_at:712:149; Interrogation_Position=2294; Antisense; ACTTGCGCATGCTCTATTTCAACAA
>probe:Drosophila_2:1627558_at:267:707; Interrogation_Position=2361; Antisense; TTACTACGCTGAGACCAACACTTGG
>probe:Drosophila_2:1627558_at:327:103; Interrogation_Position=2389; Antisense; ACCTCCTACCTAGATGGCTTGGAAA
>probe:Drosophila_2:1627558_at:88:239; Interrogation_Position=2412; Antisense; AATACTCGAGTTTCCCAACGGGCAG
>probe:Drosophila_2:1627558_at:629:565; Interrogation_Position=2458; Antisense; GGCACTGTTGAGATTCACTTTCCCA
>probe:Drosophila_2:1627558_at:296:215; Interrogation_Position=2494; Antisense; AAGATTGTGGATCCCAGCGATACGG
>probe:Drosophila_2:1627558_at:188:579; Interrogation_Position=2533; Antisense; TGGCGTTATGCGGATGGAACCCATC
>probe:Drosophila_2:1627558_at:662:271; Interrogation_Position=2554; Antisense; CATCTAGTGCAGCTCCGGAATGGTG
>probe:Drosophila_2:1627558_at:214:215; Interrogation_Position=2581; Antisense; AAGATTCTCAATCTGCCCAATGGCC
>probe:Drosophila_2:1627558_at:410:471; Interrogation_Position=2643; Antisense; GTATCCGGACGGCACTGTGAAGCTA
>probe:Drosophila_2:1627558_at:311:509; Interrogation_Position=2659; Antisense; GTGAAGCTAGTGTATCCGGATGGCA
>probe:Drosophila_2:1627558_at:124:441; Interrogation_Position=2677; Antisense; GATGGCAGCCAAGAGACGCGCTACT
>probe:Drosophila_2:1627558_at:168:285; Interrogation_Position=2706; Antisense; CGGCCGCGTTCGTTTGAAGGACAAG

Paste this into a BLAST search page for me
TGCCAACTCCAGCAGTGACTTTAAGACTTGCGCATGCTCTATTTCAACAATTACTACGCTGAGACCAACACTTGGACCTCCTACCTAGATGGCTTGGAAAAATACTCGAGTTTCCCAACGGGCAGGGCACTGTTGAGATTCACTTTCCCAAAGATTGTGGATCCCAGCGATACGGTGGCGTTATGCGGATGGAACCCATCCATCTAGTGCAGCTCCGGAATGGTGAAGATTCTCAATCTGCCCAATGGCCGTATCCGGACGGCACTGTGAAGCTAGTGAAGCTAGTGTATCCGGATGGCAGATGGCAGCCAAGAGACGCGCTACTCGGCCGCGTTCGTTTGAAGGACAAG

Full Affymetrix probeset data:

Annotations for 1627558_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime