Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627562_at:

>probe:Drosophila_2:1627562_at:714:173; Interrogation_Position=2293; Antisense; AAACTGGCATCCAAGACGGGACCCA
>probe:Drosophila_2:1627562_at:621:99; Interrogation_Position=2345; Antisense; AGATGGACATCTTCGATGCGGCGGA
>probe:Drosophila_2:1627562_at:213:155; Interrogation_Position=2389; Antisense; ACACCTTTGGTTCTGGTCGTAGGCA
>probe:Drosophila_2:1627562_at:340:225; Interrogation_Position=2413; Antisense; AAGGACTACGGCAGTGGCAGCTCAC
>probe:Drosophila_2:1627562_at:296:353; Interrogation_Position=2429; Antisense; GCAGCTCACGTGATTGGGCCGCCAA
>probe:Drosophila_2:1627562_at:694:463; Interrogation_Position=2484; Antisense; GATTGCTGAATCGTACGAGCGCATT
>probe:Drosophila_2:1627562_at:529:303; Interrogation_Position=2511; Antisense; CCGCTCAAATCTGGTGGGCATGGGC
>probe:Drosophila_2:1627562_at:296:123; Interrogation_Position=2566; Antisense; AGCGCCGATACCCTGAAACTGAGTG
>probe:Drosophila_2:1627562_at:444:535; Interrogation_Position=2652; Antisense; GGTCGATGCTGATGGCAATGTCTTT
>probe:Drosophila_2:1627562_at:156:691; Interrogation_Position=2674; Antisense; TTTGAGACCACGTTGCGTTTCGACA
>probe:Drosophila_2:1627562_at:59:399; Interrogation_Position=2695; Antisense; GACACCGAGGTGGACATAACGTACT
>probe:Drosophila_2:1627562_at:367:139; Interrogation_Position=2713; Antisense; ACGTACTACAAGAATGGCGGCATTT
>probe:Drosophila_2:1627562_at:355:507; Interrogation_Position=2773; Antisense; GTGCGTTCGTTGACTTTTATATTCC
>probe:Drosophila_2:1627562_at:260:719; Interrogation_Position=2794; Antisense; TTCCATATGCATTTCTAGGCGACTT

Paste this into a BLAST search page for me
AAACTGGCATCCAAGACGGGACCCAAGATGGACATCTTCGATGCGGCGGAACACCTTTGGTTCTGGTCGTAGGCAAAGGACTACGGCAGTGGCAGCTCACGCAGCTCACGTGATTGGGCCGCCAAGATTGCTGAATCGTACGAGCGCATTCCGCTCAAATCTGGTGGGCATGGGCAGCGCCGATACCCTGAAACTGAGTGGGTCGATGCTGATGGCAATGTCTTTTTTGAGACCACGTTGCGTTTCGACAGACACCGAGGTGGACATAACGTACTACGTACTACAAGAATGGCGGCATTTGTGCGTTCGTTGACTTTTATATTCCTTCCATATGCATTTCTAGGCGACTT

Full Affymetrix probeset data:

Annotations for 1627562_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime