Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627563_at:

>probe:Drosophila_2:1627563_at:661:521; Interrogation_Position=1143; Antisense; GTGGCCTTTTACTTTGCAACATCGA
>probe:Drosophila_2:1627563_at:657:459; Interrogation_Position=1189; Antisense; GATTTCTCATACAACCTGCTCATAT
>probe:Drosophila_2:1627563_at:607:477; Interrogation_Position=1246; Antisense; GTTTTTCTAACCACTTCTGAGCGAG
>probe:Drosophila_2:1627563_at:84:425; Interrogation_Position=1286; Antisense; GAGAGCCATTCTATCAACTCGATTC
>probe:Drosophila_2:1627563_at:601:145; Interrogation_Position=1302; Antisense; ACTCGATTCGTTCCTGACTGTGATA
>probe:Drosophila_2:1627563_at:719:663; Interrogation_Position=1368; Antisense; TAAAGGCCTCGCTGGAGATCACATC
>probe:Drosophila_2:1627563_at:453:403; Interrogation_Position=1444; Antisense; GACTTTCCCCTCAATATATCAACTG
>probe:Drosophila_2:1627563_at:223:617; Interrogation_Position=1467; Antisense; TGCAAATTGTGCATTCCCTCGACGT
>probe:Drosophila_2:1627563_at:292:637; Interrogation_Position=1485; Antisense; TCGACGTCTGATTTTACCGCGTGGT
>probe:Drosophila_2:1627563_at:615:591; Interrogation_Position=1514; Antisense; TGGGAAATCCCCTTAAATTGCGTCT
>probe:Drosophila_2:1627563_at:568:161; Interrogation_Position=1528; Antisense; AAATTGCGTCTTCTGATCGTGGCCA
>probe:Drosophila_2:1627563_at:301:143; Interrogation_Position=1598; Antisense; ACTTTAGCCAGGGTGTCAGTCGATG
>probe:Drosophila_2:1627563_at:493:17; Interrogation_Position=1656; Antisense; ATTTCTGGAAGATGACGCCCTGGCT
>probe:Drosophila_2:1627563_at:546:301; Interrogation_Position=1673; Antisense; CCCTGGCTGTTGAAATCTCCGGAGA

Paste this into a BLAST search page for me
GTGGCCTTTTACTTTGCAACATCGAGATTTCTCATACAACCTGCTCATATGTTTTTCTAACCACTTCTGAGCGAGGAGAGCCATTCTATCAACTCGATTCACTCGATTCGTTCCTGACTGTGATATAAAGGCCTCGCTGGAGATCACATCGACTTTCCCCTCAATATATCAACTGTGCAAATTGTGCATTCCCTCGACGTTCGACGTCTGATTTTACCGCGTGGTTGGGAAATCCCCTTAAATTGCGTCTAAATTGCGTCTTCTGATCGTGGCCAACTTTAGCCAGGGTGTCAGTCGATGATTTCTGGAAGATGACGCCCTGGCTCCCTGGCTGTTGAAATCTCCGGAGA

Full Affymetrix probeset data:

Annotations for 1627563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime