FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627565_at:

>probe:Drosophila_2:1627565_at:435:47; Interrogation_Position=1035; Antisense; ATCCGTGTCCGGTAATGCGAATGCC
>probe:Drosophila_2:1627565_at:414:355; Interrogation_Position=1133; Antisense; GCACTCTCGGCGATTCCATAAGGGA
>probe:Drosophila_2:1627565_at:320:401; Interrogation_Position=1156; Antisense; GACATGTCAATGACCGGCGGCAGCA
>probe:Drosophila_2:1627565_at:175:251; Interrogation_Position=1221; Antisense; CAATGGGATCGGTCGTGTCTACACG
>probe:Drosophila_2:1627565_at:657:41; Interrogation_Position=1260; Antisense; ATCGCACATTTGGTCCTTCAATGGT
>probe:Drosophila_2:1627565_at:363:227; Interrogation_Position=1279; Antisense; AATGGTATCAAGTGTCCCGTGTGCA
>probe:Drosophila_2:1627565_at:372:481; Interrogation_Position=1308; Antisense; GTTTGTGTTGCCAGACGACATCGAA
>probe:Drosophila_2:1627565_at:206:297; Interrogation_Position=1329; Antisense; CGAATGCCATTTAGTCATGTGCCTA
>probe:Drosophila_2:1627565_at:694:59; Interrogation_Position=1345; Antisense; ATGTGCCTAACGAAACCACGACTCT
>probe:Drosophila_2:1627565_at:110:437; Interrogation_Position=1378; Antisense; GAGGACGTACTCTCGGACGCCAAGG
>probe:Drosophila_2:1627565_at:580:19; Interrogation_Position=1414; Antisense; ATTTGCCTGGAGGATCTGAGTCCGG
>probe:Drosophila_2:1627565_at:438:627; Interrogation_Position=1457; Antisense; TGCCATGCCTCTGCATATATCACAA
>probe:Drosophila_2:1627565_at:512:337; Interrogation_Position=908; Antisense; GCTCCGTGCCGGATATACAGCAGCA
>probe:Drosophila_2:1627565_at:366:111; Interrogation_Position=947; Antisense; AGCAACAGGGATCGATCACCTCGTC

Paste this into a BLAST search page for me
ATCCGTGTCCGGTAATGCGAATGCCGCACTCTCGGCGATTCCATAAGGGAGACATGTCAATGACCGGCGGCAGCACAATGGGATCGGTCGTGTCTACACGATCGCACATTTGGTCCTTCAATGGTAATGGTATCAAGTGTCCCGTGTGCAGTTTGTGTTGCCAGACGACATCGAACGAATGCCATTTAGTCATGTGCCTAATGTGCCTAACGAAACCACGACTCTGAGGACGTACTCTCGGACGCCAAGGATTTGCCTGGAGGATCTGAGTCCGGTGCCATGCCTCTGCATATATCACAAGCTCCGTGCCGGATATACAGCAGCAAGCAACAGGGATCGATCACCTCGTC

Full Affymetrix probeset data:

Annotations for 1627565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720