Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627567_at:

>probe:Drosophila_2:1627567_at:531:587; Interrogation_Position=2204; Antisense; TGGAGCTCCAATCATCCATACAACG
>probe:Drosophila_2:1627567_at:691:433; Interrogation_Position=2242; Antisense; GAGGATTCAACCCTTCGAAACCGAG
>probe:Drosophila_2:1627567_at:133:217; Interrogation_Position=2276; Antisense; AAGTTTCTCACATCGCCGGGCGATA
>probe:Drosophila_2:1627567_at:535:459; Interrogation_Position=2297; Antisense; GATATTTTGAAGGACACGCTGTGCA
>probe:Drosophila_2:1627567_at:381:367; Interrogation_Position=2359; Antisense; GAATCGACCATTCCATAATCGCAGA
>probe:Drosophila_2:1627567_at:49:109; Interrogation_Position=2381; Antisense; AGAATTAACAAGTACCGCGGTGGCT
>probe:Drosophila_2:1627567_at:281:521; Interrogation_Position=2400; Antisense; GTGGCTTGACCTACGATCATGTCAT
>probe:Drosophila_2:1627567_at:90:647; Interrogation_Position=2416; Antisense; TCATGTCATTGATCCCAAGTGGGCA
>probe:Drosophila_2:1627567_at:343:135; Interrogation_Position=2440; Antisense; ACGCGTCGCTTGTGGCAAGTCCAGA
>probe:Drosophila_2:1627567_at:158:553; Interrogation_Position=2482; Antisense; GGAGCAGGCTTATGCGTGCCTCAAA
>probe:Drosophila_2:1627567_at:515:183; Interrogation_Position=2505; Antisense; AAAATCTGTCCTGTATTTCGCGCTC
>probe:Drosophila_2:1627567_at:525:599; Interrogation_Position=2554; Antisense; TTTGGTGAATTCGTTCGACCGCTTT
>probe:Drosophila_2:1627567_at:613:341; Interrogation_Position=2574; Antisense; GCTTTGGTTCGCTCTAAATTCTATG
>probe:Drosophila_2:1627567_at:32:571; Interrogation_Position=2723; Antisense; GGCATTATTGGTTACATCCACCTTA

Paste this into a BLAST search page for me
TGGAGCTCCAATCATCCATACAACGGAGGATTCAACCCTTCGAAACCGAGAAGTTTCTCACATCGCCGGGCGATAGATATTTTGAAGGACACGCTGTGCAGAATCGACCATTCCATAATCGCAGAAGAATTAACAAGTACCGCGGTGGCTGTGGCTTGACCTACGATCATGTCATTCATGTCATTGATCCCAAGTGGGCAACGCGTCGCTTGTGGCAAGTCCAGAGGAGCAGGCTTATGCGTGCCTCAAAAAAATCTGTCCTGTATTTCGCGCTCTTTGGTGAATTCGTTCGACCGCTTTGCTTTGGTTCGCTCTAAATTCTATGGGCATTATTGGTTACATCCACCTTA

Full Affymetrix probeset data:

Annotations for 1627567_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime