Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627568_at:

>probe:Drosophila_2:1627568_at:156:609; Interrogation_Position=190; Antisense; TGAGCTGACCCTTCTGAATGCCCAG
>probe:Drosophila_2:1627568_at:531:397; Interrogation_Position=219; Antisense; GACAAGTGCGGCAGTCCACCGAGGA
>probe:Drosophila_2:1627568_at:639:87; Interrogation_Position=255; Antisense; AGTCCCACGTTGAATCCTCATCGGA
>probe:Drosophila_2:1627568_at:64:91; Interrogation_Position=283; Antisense; AGTAACAGTTGCTTCATCCGCCAGT
>probe:Drosophila_2:1627568_at:461:629; Interrogation_Position=299; Antisense; TCCGCCAGTGCTTCTGGAGAGTTCA
>probe:Drosophila_2:1627568_at:12:355; Interrogation_Position=481; Antisense; GCACATGTCCTCCAGGCAAACGGTA
>probe:Drosophila_2:1627568_at:460:177; Interrogation_Position=498; Antisense; AAACGGTACAGGTCCAGAGCTCCAC
>probe:Drosophila_2:1627568_at:39:293; Interrogation_Position=552; Antisense; CGTCAGAAGTCCGAGTGGCCAGCGA
>probe:Drosophila_2:1627568_at:294:375; Interrogation_Position=596; Antisense; GAAGAGAATCCATCGACCTCGTCGA
>probe:Drosophila_2:1627568_at:285:419; Interrogation_Position=638; Antisense; GAGCTCCTGAATTCCATGCTTAACA
>probe:Drosophila_2:1627568_at:697:341; Interrogation_Position=655; Antisense; GCTTAACATGTTCACGGACTTCACC
>probe:Drosophila_2:1627568_at:674:711; Interrogation_Position=674; Antisense; TTCACCAGTGATCTACGCGGTCAAG
>probe:Drosophila_2:1627568_at:197:101; Interrogation_Position=717; Antisense; AGAGGGATCGGATTCGTGCGCTCAA
>probe:Drosophila_2:1627568_at:509:77; Interrogation_Position=741; Antisense; AGGAGGACATCATCCAGCGCAAGCA

Paste this into a BLAST search page for me
TGAGCTGACCCTTCTGAATGCCCAGGACAAGTGCGGCAGTCCACCGAGGAAGTCCCACGTTGAATCCTCATCGGAAGTAACAGTTGCTTCATCCGCCAGTTCCGCCAGTGCTTCTGGAGAGTTCAGCACATGTCCTCCAGGCAAACGGTAAAACGGTACAGGTCCAGAGCTCCACCGTCAGAAGTCCGAGTGGCCAGCGAGAAGAGAATCCATCGACCTCGTCGAGAGCTCCTGAATTCCATGCTTAACAGCTTAACATGTTCACGGACTTCACCTTCACCAGTGATCTACGCGGTCAAGAGAGGGATCGGATTCGTGCGCTCAAAGGAGGACATCATCCAGCGCAAGCA

Full Affymetrix probeset data:

Annotations for 1627568_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime