Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627570_a_at:

>probe:Drosophila_2:1627570_a_at:24:589; Interrogation_Position=138; Antisense; TGGAGACGCTGCCATGTGCCAACCA
>probe:Drosophila_2:1627570_a_at:452:113; Interrogation_Position=186; Antisense; AGCAGCAGCACGTGAATCTCAGCAT
>probe:Drosophila_2:1627570_a_at:194:365; Interrogation_Position=199; Antisense; GAATCTCAGCATAGATCCTAGTCTG
>probe:Drosophila_2:1627570_a_at:491:109; Interrogation_Position=297; Antisense; AGCAATGTGGGTTGGTCCGACGTCC
>probe:Drosophila_2:1627570_a_at:103:297; Interrogation_Position=314; Antisense; CGACGTCCAGTGCAAGTCCAAGTGG
>probe:Drosophila_2:1627570_a_at:567:307; Interrogation_Position=343; Antisense; CCATGAGGGATCAGTACTGCCGGGA
>probe:Drosophila_2:1627570_a_at:299:145; Interrogation_Position=358; Antisense; ACTGCCGGGAGCTGAAGCGCGCCAA
>probe:Drosophila_2:1627570_a_at:714:171; Interrogation_Position=417; Antisense; AAAGAGCTGGATTTCCTGCGTCCAT
>probe:Drosophila_2:1627570_a_at:564:283; Interrogation_Position=432; Antisense; CTGCGTCCATATGCGCTGGCAAGAA
>probe:Drosophila_2:1627570_a_at:284:435; Interrogation_Position=463; Antisense; GAGGGAGATCTGGTCAGACTTCCAA
>probe:Drosophila_2:1627570_a_at:566:263; Interrogation_Position=477; Antisense; CAGACTTCCAATGGCGCCGTGGGTA
>probe:Drosophila_2:1627570_a_at:358:109; Interrogation_Position=559; Antisense; AGAATCTAAACCTTTCCGGCAGCAT
>probe:Drosophila_2:1627570_a_at:34:617; Interrogation_Position=624; Antisense; TGCAGCTTCAGTTCGCCTAGTTCAA
>probe:Drosophila_2:1627570_a_at:167:163; Interrogation_Position=85; Antisense; ACAATTGCCCATATTAACACACCGC

Paste this into a BLAST search page for me
TGGAGACGCTGCCATGTGCCAACCAAGCAGCAGCACGTGAATCTCAGCATGAATCTCAGCATAGATCCTAGTCTGAGCAATGTGGGTTGGTCCGACGTCCCGACGTCCAGTGCAAGTCCAAGTGGCCATGAGGGATCAGTACTGCCGGGAACTGCCGGGAGCTGAAGCGCGCCAAAAAGAGCTGGATTTCCTGCGTCCATCTGCGTCCATATGCGCTGGCAAGAAGAGGGAGATCTGGTCAGACTTCCAACAGACTTCCAATGGCGCCGTGGGTAAGAATCTAAACCTTTCCGGCAGCATTGCAGCTTCAGTTCGCCTAGTTCAAACAATTGCCCATATTAACACACCGC

Full Affymetrix probeset data:

Annotations for 1627570_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime