FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627571_at:

>probe:Drosophila_2:1627571_at:39:483; Interrogation_Position=3849; Antisense; GTATTCTTTTCGCAGCGTTCTAAAT
>probe:Drosophila_2:1627571_at:12:299; Interrogation_Position=3859; Antisense; CGCAGCGTTCTAAATGAGTCATTCT
>probe:Drosophila_2:1627571_at:466:429; Interrogation_Position=3874; Antisense; GAGTCATTCTAGTTTTTATTAGTTG
>probe:Drosophila_2:1627571_at:576:385; Interrogation_Position=3926; Antisense; GAAATTTCAAGCGTAACCCGTTGAT
>probe:Drosophila_2:1627571_at:705:321; Interrogation_Position=3936; Antisense; GCGTAACCCGTTGATTTCCTATCAA
>probe:Drosophila_2:1627571_at:428:117; Interrogation_Position=3992; Antisense; AGCTATTTCTACGTATGTCTGTGCA
>probe:Drosophila_2:1627571_at:702:61; Interrogation_Position=4006; Antisense; ATGTCTGTGCATGTGTGTATAAATC
>probe:Drosophila_2:1627571_at:377:33; Interrogation_Position=4028; Antisense; ATCAAGCGGGCGAAGTTGTGCAATT
>probe:Drosophila_2:1627571_at:207:465; Interrogation_Position=4110; Antisense; GTTGAAAAACAAAACGCTCGTGCAA
>probe:Drosophila_2:1627571_at:186:335; Interrogation_Position=4125; Antisense; GCTCGTGCAATGACAAACAAAATTT
>probe:Drosophila_2:1627571_at:385:669; Interrogation_Position=4234; Antisense; TACGACTATTTACTATTTTTTGGCT
>probe:Drosophila_2:1627571_at:618:689; Interrogation_Position=4252; Antisense; TTTGGCTATAGCATTTTAAACGCAT
>probe:Drosophila_2:1627571_at:204:179; Interrogation_Position=4346; Antisense; AAACTTTTATGATTGGTTGCTGTAA
>probe:Drosophila_2:1627571_at:459:11; Interrogation_Position=4404; Antisense; ATTCAAACAACCATACAAACAGCAG

Paste this into a BLAST search page for me
GTATTCTTTTCGCAGCGTTCTAAATCGCAGCGTTCTAAATGAGTCATTCTGAGTCATTCTAGTTTTTATTAGTTGGAAATTTCAAGCGTAACCCGTTGATGCGTAACCCGTTGATTTCCTATCAAAGCTATTTCTACGTATGTCTGTGCAATGTCTGTGCATGTGTGTATAAATCATCAAGCGGGCGAAGTTGTGCAATTGTTGAAAAACAAAACGCTCGTGCAAGCTCGTGCAATGACAAACAAAATTTTACGACTATTTACTATTTTTTGGCTTTTGGCTATAGCATTTTAAACGCATAAACTTTTATGATTGGTTGCTGTAAATTCAAACAACCATACAAACAGCAG

Full Affymetrix probeset data:

Annotations for 1627571_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720