FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627572_at:

>probe:Drosophila_2:1627572_at:190:183; Interrogation_Position=381; Antisense; AAAAGCGTTCGTCTTGGCGAGCATG
>probe:Drosophila_2:1627572_at:274:575; Interrogation_Position=396; Antisense; GGCGAGCATGACATCACCTATGATC
>probe:Drosophila_2:1627572_at:36:681; Interrogation_Position=414; Antisense; TATGATCCAGCCTACAATCCGGACT
>probe:Drosophila_2:1627572_at:479:65; Interrogation_Position=448; Antisense; AGGATAACCAATGTGCCCTTCCAAA
>probe:Drosophila_2:1627572_at:649:683; Interrogation_Position=548; Antisense; TATCGCCCTCTTACGACTCAAAATG
>probe:Drosophila_2:1627572_at:620:231; Interrogation_Position=569; Antisense; AATGCCAGTGCGCTATAGGACAGGA
>probe:Drosophila_2:1627572_at:133:209; Interrogation_Position=615; Antisense; AAGCACGGCTTTTTCGCGAAATCCA
>probe:Drosophila_2:1627572_at:50:707; Interrogation_Position=682; Antisense; TTAGCCAAGTACTGATGCACGGATT
>probe:Drosophila_2:1627572_at:173:635; Interrogation_Position=724; Antisense; TCGCAGTGTGCGCATTAAGGTTTCC
>probe:Drosophila_2:1627572_at:145:671; Interrogation_Position=792; Antisense; TACGATGGCGTCGATACCTGCCAAG
>probe:Drosophila_2:1627572_at:202:89; Interrogation_Position=855; Antisense; AGTAGTGTTTACTTGGCTGGCATCA
>probe:Drosophila_2:1627572_at:49:583; Interrogation_Position=872; Antisense; TGGCATCACCACCTATGGCAGTAAA
>probe:Drosophila_2:1627572_at:105:723; Interrogation_Position=899; Antisense; TTGCGGCCAGATTGGCATTCCTGGA
>probe:Drosophila_2:1627572_at:672:379; Interrogation_Position=934; Antisense; GAACCAGTGCATTCCTGCCATGGAT

Paste this into a BLAST search page for me
AAAAGCGTTCGTCTTGGCGAGCATGGGCGAGCATGACATCACCTATGATCTATGATCCAGCCTACAATCCGGACTAGGATAACCAATGTGCCCTTCCAAATATCGCCCTCTTACGACTCAAAATGAATGCCAGTGCGCTATAGGACAGGAAAGCACGGCTTTTTCGCGAAATCCATTAGCCAAGTACTGATGCACGGATTTCGCAGTGTGCGCATTAAGGTTTCCTACGATGGCGTCGATACCTGCCAAGAGTAGTGTTTACTTGGCTGGCATCATGGCATCACCACCTATGGCAGTAAATTGCGGCCAGATTGGCATTCCTGGAGAACCAGTGCATTCCTGCCATGGAT

Full Affymetrix probeset data:

Annotations for 1627572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720