FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627574_at:

>probe:Drosophila_2:1627574_at:578:595; Interrogation_Position=1022; Antisense; TGTGGAGCAGGAGCTAACCGCCCAG
>probe:Drosophila_2:1627574_at:715:135; Interrogation_Position=1075; Antisense; ACGAACTGAGCGTGGCGGATATCTC
>probe:Drosophila_2:1627574_at:304:23; Interrogation_Position=1093; Antisense; ATATCTCGCTGGGATTGCTGCTGCA
>probe:Drosophila_2:1627574_at:644:7; Interrogation_Position=1106; Antisense; ATTGCTGCTGCATCGACTGTATCAG
>probe:Drosophila_2:1627574_at:53:367; Interrogation_Position=1142; Antisense; GAATCAGTTCTGGACCTTCGGAAAG
>probe:Drosophila_2:1627574_at:226:81; Interrogation_Position=1174; Antisense; AGGTGGAGGCATACTTCTTGCGCTT
>probe:Drosophila_2:1627574_at:45:111; Interrogation_Position=1233; Antisense; AGCAACTTTGCCATACTGCGCGAAA
>probe:Drosophila_2:1627574_at:267:665; Interrogation_Position=1246; Antisense; TACTGCGCGAAATGTGGACCCGAAC
>probe:Drosophila_2:1627574_at:90:381; Interrogation_Position=1267; Antisense; GAACGCCGGGCAACTATAAGCTAGG
>probe:Drosophila_2:1627574_at:543:353; Interrogation_Position=1352; Antisense; GCAGCGGGACAGCAGACTTTGTTAA
>probe:Drosophila_2:1627574_at:138:381; Interrogation_Position=1426; Antisense; GAACGCTTAAAGCTACGCACTGCTG
>probe:Drosophila_2:1627574_at:514:109; Interrogation_Position=1505; Antisense; AGAAGAGCGCGCGATCCAGTGCCAG
>probe:Drosophila_2:1627574_at:244:317; Interrogation_Position=1529; Antisense; GCCTCGGCTGCTTGCTTAGTAATAT
>probe:Drosophila_2:1627574_at:210:271; Interrogation_Position=1557; Antisense; CATCGTTTCATATCATCGTTGCTGA

Paste this into a BLAST search page for me
TGTGGAGCAGGAGCTAACCGCCCAGACGAACTGAGCGTGGCGGATATCTCATATCTCGCTGGGATTGCTGCTGCAATTGCTGCTGCATCGACTGTATCAGGAATCAGTTCTGGACCTTCGGAAAGAGGTGGAGGCATACTTCTTGCGCTTAGCAACTTTGCCATACTGCGCGAAATACTGCGCGAAATGTGGACCCGAACGAACGCCGGGCAACTATAAGCTAGGGCAGCGGGACAGCAGACTTTGTTAAGAACGCTTAAAGCTACGCACTGCTGAGAAGAGCGCGCGATCCAGTGCCAGGCCTCGGCTGCTTGCTTAGTAATATCATCGTTTCATATCATCGTTGCTGA

Full Affymetrix probeset data:

Annotations for 1627574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720