Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627576_at:

>probe:Drosophila_2:1627576_at:56:283; Interrogation_Position=1523; Antisense; CTCCCCTTTTAGCTGATGATACCAA
>probe:Drosophila_2:1627576_at:429:409; Interrogation_Position=1561; Antisense; GACGAAACCCATTTCACTGGCTATA
>probe:Drosophila_2:1627576_at:298:377; Interrogation_Position=1595; Antisense; GAAGCGGCAGTATCCTCTACGACAC
>probe:Drosophila_2:1627576_at:48:337; Interrogation_Position=1659; Antisense; GCTACCCACAAATACCTTGGACATT
>probe:Drosophila_2:1627576_at:231:563; Interrogation_Position=1695; Antisense; GGCAAAACCCCATGGAAATGTTCTG
>probe:Drosophila_2:1627576_at:721:669; Interrogation_Position=1733; Antisense; TACGGACTGTCATGTTCAAGCGGCA
>probe:Drosophila_2:1627576_at:637:351; Interrogation_Position=1772; Antisense; GCAGAAAGCTATACACCTCCATGAG
>probe:Drosophila_2:1627576_at:422:429; Interrogation_Position=1794; Antisense; GAGTAATCAGTCTACGGATCTACAA
>probe:Drosophila_2:1627576_at:127:459; Interrogation_Position=1825; Antisense; GATATACTCGACCAACTCACTGGAA
>probe:Drosophila_2:1627576_at:315:377; Interrogation_Position=1874; Antisense; GAAGCATTTCAACCATTTGTACATA
>probe:Drosophila_2:1627576_at:528:487; Interrogation_Position=1963; Antisense; GTACGTCGCCACCTGAATGTCATAG
>probe:Drosophila_2:1627576_at:594:25; Interrogation_Position=1984; Antisense; ATAGGTCAGGTCAGGCATACACACA
>probe:Drosophila_2:1627576_at:156:177; Interrogation_Position=2008; Antisense; AAACATGTATGTTCCTCGGGTGGCG
>probe:Drosophila_2:1627576_at:710:483; Interrogation_Position=2037; Antisense; GTATCGCATCGGAAACAGTTTAGAC

Paste this into a BLAST search page for me
CTCCCCTTTTAGCTGATGATACCAAGACGAAACCCATTTCACTGGCTATAGAAGCGGCAGTATCCTCTACGACACGCTACCCACAAATACCTTGGACATTGGCAAAACCCCATGGAAATGTTCTGTACGGACTGTCATGTTCAAGCGGCAGCAGAAAGCTATACACCTCCATGAGGAGTAATCAGTCTACGGATCTACAAGATATACTCGACCAACTCACTGGAAGAAGCATTTCAACCATTTGTACATAGTACGTCGCCACCTGAATGTCATAGATAGGTCAGGTCAGGCATACACACAAAACATGTATGTTCCTCGGGTGGCGGTATCGCATCGGAAACAGTTTAGAC

Full Affymetrix probeset data:

Annotations for 1627576_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime