FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627577_at:

>probe:Drosophila_2:1627577_at:286:541; Interrogation_Position=208; Antisense; GGATTTGAACGACTGGGACTTGCCC
>probe:Drosophila_2:1627577_at:432:557; Interrogation_Position=223; Antisense; GGACTTGCCCTACTGGAAGCGATCA
>probe:Drosophila_2:1627577_at:278:379; Interrogation_Position=238; Antisense; GAAGCGATCACTATCTCGCGTTGGA
>probe:Drosophila_2:1627577_at:38:581; Interrogation_Position=310; Antisense; GGCCAATGTGGATGTGCACCTGTTC
>probe:Drosophila_2:1627577_at:407:353; Interrogation_Position=325; Antisense; GCACCTGTTCAAGCCCTATGAGATT
>probe:Drosophila_2:1627577_at:80:15; Interrogation_Position=347; Antisense; ATTAGCGTGAAGACCTCAGGCGACA
>probe:Drosophila_2:1627577_at:491:65; Interrogation_Position=408; Antisense; ATGGTGACACCTTCGTGGGTCGCCA
>probe:Drosophila_2:1627577_at:565:591; Interrogation_Position=423; Antisense; TGGGTCGCCACATCGTCAAGCGGTT
>probe:Drosophila_2:1627577_at:286:383; Interrogation_Position=488; Antisense; GAACTGTCGTCCGATGGCATACTTA
>probe:Drosophila_2:1627577_at:449:569; Interrogation_Position=503; Antisense; GGCATACTTACCGTCAAGTGTCCGC
>probe:Drosophila_2:1627577_at:122:515; Interrogation_Position=520; Antisense; GTGTCCGCCGTATTTGACCAACGAG
>probe:Drosophila_2:1627577_at:73:301; Interrogation_Position=560; Antisense; CGCCAAGTGGGTCCTTCGTATCTAA
>probe:Drosophila_2:1627577_at:618:115; Interrogation_Position=610; Antisense; AGCATCGTAACTCCGTGTTTTGTTC
>probe:Drosophila_2:1627577_at:273:713; Interrogation_Position=632; Antisense; TTCTTAGTTACTTTCTGTTGGAGCT

Paste this into a BLAST search page for me
GGATTTGAACGACTGGGACTTGCCCGGACTTGCCCTACTGGAAGCGATCAGAAGCGATCACTATCTCGCGTTGGAGGCCAATGTGGATGTGCACCTGTTCGCACCTGTTCAAGCCCTATGAGATTATTAGCGTGAAGACCTCAGGCGACAATGGTGACACCTTCGTGGGTCGCCATGGGTCGCCACATCGTCAAGCGGTTGAACTGTCGTCCGATGGCATACTTAGGCATACTTACCGTCAAGTGTCCGCGTGTCCGCCGTATTTGACCAACGAGCGCCAAGTGGGTCCTTCGTATCTAAAGCATCGTAACTCCGTGTTTTGTTCTTCTTAGTTACTTTCTGTTGGAGCT

Full Affymetrix probeset data:

Annotations for 1627577_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720