Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627579_at:

>probe:Drosophila_2:1627579_at:135:287; Interrogation_Position=2046; Antisense; CTGGGTCTCTTCGACTGGCGGCGAA
>probe:Drosophila_2:1627579_at:406:351; Interrogation_Position=2117; Antisense; GCAGACGCAGCTAAGGGCCAACGAA
>probe:Drosophila_2:1627579_at:198:621; Interrogation_Position=2192; Antisense; TGCTCGGATTAGTCCTCCAACTGGA
>probe:Drosophila_2:1627579_at:299:77; Interrogation_Position=2226; Antisense; AGGATGTCCTACTATCGACGCGAGG
>probe:Drosophila_2:1627579_at:662:197; Interrogation_Position=2279; Antisense; AACGCCACAGTACAATTCCGTGTCG
>probe:Drosophila_2:1627579_at:182:517; Interrogation_Position=2298; Antisense; GTGTCGAAGATCGATCGCGCCTCGA
>probe:Drosophila_2:1627579_at:605:341; Interrogation_Position=2339; Antisense; GCTATTCATCCTTATCAACGTGTTC
>probe:Drosophila_2:1627579_at:723:191; Interrogation_Position=2355; Antisense; AACGTGTTCTACTGGTACGGCTACT
>probe:Drosophila_2:1627579_at:274:669; Interrogation_Position=2370; Antisense; TACGGCTACTTGTCGAGGAGCTCAA
>probe:Drosophila_2:1627579_at:296:223; Interrogation_Position=2393; Antisense; AAGGATTTTGGCCAACACGCCGGAT
>probe:Drosophila_2:1627579_at:711:419; Interrogation_Position=2420; Antisense; GAGCACCTGATGTTACCTTTTAGCA
>probe:Drosophila_2:1627579_at:387:373; Interrogation_Position=2450; Antisense; GACAGGGTCCTCGAAGAAATCATTA
>probe:Drosophila_2:1627579_at:494:161; Interrogation_Position=2466; Antisense; AAATCATTAAGCGATCGCCGGCGGC
>probe:Drosophila_2:1627579_at:65:633; Interrogation_Position=2480; Antisense; TCGCCGGCGGCAAACTTACAACTAA

Paste this into a BLAST search page for me
CTGGGTCTCTTCGACTGGCGGCGAAGCAGACGCAGCTAAGGGCCAACGAATGCTCGGATTAGTCCTCCAACTGGAAGGATGTCCTACTATCGACGCGAGGAACGCCACAGTACAATTCCGTGTCGGTGTCGAAGATCGATCGCGCCTCGAGCTATTCATCCTTATCAACGTGTTCAACGTGTTCTACTGGTACGGCTACTTACGGCTACTTGTCGAGGAGCTCAAAAGGATTTTGGCCAACACGCCGGATGAGCACCTGATGTTACCTTTTAGCAGACAGGGTCCTCGAAGAAATCATTAAAATCATTAAGCGATCGCCGGCGGCTCGCCGGCGGCAAACTTACAACTAA

Full Affymetrix probeset data:

Annotations for 1627579_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime