FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627580_at:

>probe:Drosophila_2:1627580_at:93:301; Interrogation_Position=6278; Antisense; CGCCGGGCCTTAACGATGTGATTGA
>probe:Drosophila_2:1627580_at:27:723; Interrogation_Position=6299; Antisense; TTGACCGTTTTGTGCGGATCCAGCA
>probe:Drosophila_2:1627580_at:80:431; Interrogation_Position=6349; Antisense; GAGTACTACTTATTGTCCGAGGAGG
>probe:Drosophila_2:1627580_at:171:135; Interrogation_Position=6383; Antisense; ACGCCGAGGACGTTGAGGTGCCCAA
>probe:Drosophila_2:1627580_at:684:1; Interrogation_Position=6407; Antisense; AGGCATTGGGCGACGTTTTCGAGTC
>probe:Drosophila_2:1627580_at:242:701; Interrogation_Position=6422; Antisense; TTTTCGAGTCGATCGCAGGTGCCAT
>probe:Drosophila_2:1627580_at:677:503; Interrogation_Position=6440; Antisense; GTGCCATTTTTCTCGACTCAAACAT
>probe:Drosophila_2:1627580_at:439:153; Interrogation_Position=6461; Antisense; ACATGTCGCTGGACGTGGTTTGGCA
>probe:Drosophila_2:1627580_at:75:607; Interrogation_Position=6500; Antisense; TGATGAGCCCGGAGATCGAGCAGTT
>probe:Drosophila_2:1627580_at:157:421; Interrogation_Position=6517; Antisense; GAGCAGTTCAGCAACTCAGTGCCAA
>probe:Drosophila_2:1627580_at:715:119; Interrogation_Position=6566; Antisense; AGCTGGAGCCGGAAACCGCCAAGTT
>probe:Drosophila_2:1627580_at:198:473; Interrogation_Position=6631; Antisense; GTTACCGTGGATGTCTTCTGCAAAG
>probe:Drosophila_2:1627580_at:617:623; Interrogation_Position=6712; Antisense; TGCGCATTGCGCCAACTCAAAAAGC
>probe:Drosophila_2:1627580_at:308:219; Interrogation_Position=6764; Antisense; AAGTCATCGCTGCAATCGTGTTTCA

Paste this into a BLAST search page for me
CGCCGGGCCTTAACGATGTGATTGATTGACCGTTTTGTGCGGATCCAGCAGAGTACTACTTATTGTCCGAGGAGGACGCCGAGGACGTTGAGGTGCCCAAAGGCATTGGGCGACGTTTTCGAGTCTTTTCGAGTCGATCGCAGGTGCCATGTGCCATTTTTCTCGACTCAAACATACATGTCGCTGGACGTGGTTTGGCATGATGAGCCCGGAGATCGAGCAGTTGAGCAGTTCAGCAACTCAGTGCCAAAGCTGGAGCCGGAAACCGCCAAGTTGTTACCGTGGATGTCTTCTGCAAAGTGCGCATTGCGCCAACTCAAAAAGCAAGTCATCGCTGCAATCGTGTTTCA

Full Affymetrix probeset data:

Annotations for 1627580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720