FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627581_at:

>probe:Drosophila_2:1627581_at:157:213; Interrogation_Position=1321; Antisense; AAGACCAAATGCTCCGGACTGTGCG
>probe:Drosophila_2:1627581_at:554:345; Interrogation_Position=1382; Antisense; GCATCAATCGCATCACAAGCCGAGA
>probe:Drosophila_2:1627581_at:138:99; Interrogation_Position=1404; Antisense; AGATGTGGACGACCTGTTGCGTTCC
>probe:Drosophila_2:1627581_at:464:53; Interrogation_Position=1472; Antisense; ATGCAGAGGAGATCGCCCAGCGGTA
>probe:Drosophila_2:1627581_at:554:9; Interrogation_Position=1541; Antisense; ATTCCATCCGGGAGCAAATCTGCGT
>probe:Drosophila_2:1627581_at:300:351; Interrogation_Position=1611; Antisense; GCAGACCGTGTTTGTCAAGTCGCAT
>probe:Drosophila_2:1627581_at:253:219; Interrogation_Position=1627; Antisense; AAGTCGCATTGCATCGATGCCAACC
>probe:Drosophila_2:1627581_at:456:683; Interrogation_Position=1656; Antisense; TATAGATGGCAGCATTTCGTTCCCC
>probe:Drosophila_2:1627581_at:352:253; Interrogation_Position=1683; Antisense; CAACGATGGCGCCAAGGCTTTGCTA
>probe:Drosophila_2:1627581_at:704:225; Interrogation_Position=1696; Antisense; AAGGCTTTGCTAGAGGTTCACCCAG
>probe:Drosophila_2:1627581_at:332:375; Interrogation_Position=1720; Antisense; GAAGATGCCCTTCTGACAATCGCTT
>probe:Drosophila_2:1627581_at:198:397; Interrogation_Position=1734; Antisense; GACAATCGCTTTAGACTGAATCCAG
>probe:Drosophila_2:1627581_at:117:615; Interrogation_Position=1750; Antisense; TGAATCCAGTGATGCGCCCCTAGTG
>probe:Drosophila_2:1627581_at:534:497; Interrogation_Position=1779; Antisense; GTCATCTCGCTCTAGCATGTCTGAA

Paste this into a BLAST search page for me
AAGACCAAATGCTCCGGACTGTGCGGCATCAATCGCATCACAAGCCGAGAAGATGTGGACGACCTGTTGCGTTCCATGCAGAGGAGATCGCCCAGCGGTAATTCCATCCGGGAGCAAATCTGCGTGCAGACCGTGTTTGTCAAGTCGCATAAGTCGCATTGCATCGATGCCAACCTATAGATGGCAGCATTTCGTTCCCCCAACGATGGCGCCAAGGCTTTGCTAAAGGCTTTGCTAGAGGTTCACCCAGGAAGATGCCCTTCTGACAATCGCTTGACAATCGCTTTAGACTGAATCCAGTGAATCCAGTGATGCGCCCCTAGTGGTCATCTCGCTCTAGCATGTCTGAA

Full Affymetrix probeset data:

Annotations for 1627581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720