Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627585_a_at:

>probe:Drosophila_2:1627585_a_at:277:547; Interrogation_Position=1014; Antisense; GGATGCCAATTTCATCGACATCGAT
>probe:Drosophila_2:1627585_a_at:59:637; Interrogation_Position=1028; Antisense; TCGACATCGATGACCAGTTCCAGCG
>probe:Drosophila_2:1627585_a_at:125:501; Interrogation_Position=1097; Antisense; GTCGAGAAACAACAACGCCTATTAA
>probe:Drosophila_2:1627585_a_at:59:101; Interrogation_Position=659; Antisense; AGAGGACCACTTTCAGCACAGAGCA
>probe:Drosophila_2:1627585_a_at:706:355; Interrogation_Position=674; Antisense; GCACAGAGCAGACGCTTCGCCTGGA
>probe:Drosophila_2:1627585_a_at:728:717; Interrogation_Position=689; Antisense; TTCGCCTGGAGGTGGAGTTCCATCG
>probe:Drosophila_2:1627585_a_at:70:381; Interrogation_Position=714; Antisense; GAACGAGTACATCTCCAGGAGTCGT
>probe:Drosophila_2:1627585_a_at:189:89; Interrogation_Position=733; Antisense; AGTCGTCGCTTCGAGCTGGCCGAAA
>probe:Drosophila_2:1627585_a_at:693:635; Interrogation_Position=801; Antisense; TCGCAGGGCCAAGGACAAACGCATT
>probe:Drosophila_2:1627585_a_at:59:573; Interrogation_Position=831; Antisense; GGCTCAGATCGATCAGCACTACAGA
>probe:Drosophila_2:1627585_a_at:361:277; Interrogation_Position=849; Antisense; CTACAGAAACTTTGTCGTGGCCAAT
>probe:Drosophila_2:1627585_a_at:554:289; Interrogation_Position=864; Antisense; CGTGGCCAATGGTTTTATGAGCTCT
>probe:Drosophila_2:1627585_a_at:614:277; Interrogation_Position=887; Antisense; CTATAATGGGTCAGGCTGCCACGAC
>probe:Drosophila_2:1627585_a_at:17:593; Interrogation_Position=947; Antisense; TGGGCGTGGGCCTAAACTACTATGC

Paste this into a BLAST search page for me
GGATGCCAATTTCATCGACATCGATTCGACATCGATGACCAGTTCCAGCGGTCGAGAAACAACAACGCCTATTAAAGAGGACCACTTTCAGCACAGAGCAGCACAGAGCAGACGCTTCGCCTGGATTCGCCTGGAGGTGGAGTTCCATCGGAACGAGTACATCTCCAGGAGTCGTAGTCGTCGCTTCGAGCTGGCCGAAATCGCAGGGCCAAGGACAAACGCATTGGCTCAGATCGATCAGCACTACAGACTACAGAAACTTTGTCGTGGCCAATCGTGGCCAATGGTTTTATGAGCTCTCTATAATGGGTCAGGCTGCCACGACTGGGCGTGGGCCTAAACTACTATGC

Full Affymetrix probeset data:

Annotations for 1627585_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime