FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627587_at:

>probe:Drosophila_2:1627587_at:30:337; Interrogation_Position=138; Antisense; GCTCCAGCAGTTGGCCATGTGCGGA
>probe:Drosophila_2:1627587_at:603:61; Interrogation_Position=154; Antisense; ATGTGCGGATTCTATGAGGACCTGG
>probe:Drosophila_2:1627587_at:495:115; Interrogation_Position=209; Antisense; AGCAGGGACGCTTCTGGTATGCAGT
>probe:Drosophila_2:1627587_at:519:331; Interrogation_Position=246; Antisense; GCTGGAGGTGCGATACCATGCCCAC
>probe:Drosophila_2:1627587_at:523:447; Interrogation_Position=274; Antisense; GATGCCGATGGCAAGGTAAGTCCTT
>probe:Drosophila_2:1627587_at:505:657; Interrogation_Position=290; Antisense; TAAGTCCTTACTTACACCAGTCAGG
>probe:Drosophila_2:1627587_at:131:425; Interrogation_Position=319; Antisense; GAGACATCCTGGAACACTATTCCGC
>probe:Drosophila_2:1627587_at:510:423; Interrogation_Position=358; Antisense; GAGACAATGCGCGTGCTGAGCAATA
>probe:Drosophila_2:1627587_at:639:453; Interrogation_Position=388; Antisense; GATAGTGATTACTCGGCGTACCCGC
>probe:Drosophila_2:1627587_at:228:487; Interrogation_Position=405; Antisense; GTACCCGCCGTGTTGCATATCCGAT
>probe:Drosophila_2:1627587_at:377:449; Interrogation_Position=427; Antisense; GATCCGCCGTGCATGCTCAATATTC
>probe:Drosophila_2:1627587_at:244:493; Interrogation_Position=44; Antisense; GTCAAATTCCTTGCGACCGGAACCT
>probe:Drosophila_2:1627587_at:314:131; Interrogation_Position=59; Antisense; ACCGGAACCTGCGTGATGTGGAGCT
>probe:Drosophila_2:1627587_at:340:519; Interrogation_Position=76; Antisense; GTGGAGCTAATTTCGTGCCGGTTGC

Paste this into a BLAST search page for me
GCTCCAGCAGTTGGCCATGTGCGGAATGTGCGGATTCTATGAGGACCTGGAGCAGGGACGCTTCTGGTATGCAGTGCTGGAGGTGCGATACCATGCCCACGATGCCGATGGCAAGGTAAGTCCTTTAAGTCCTTACTTACACCAGTCAGGGAGACATCCTGGAACACTATTCCGCGAGACAATGCGCGTGCTGAGCAATAGATAGTGATTACTCGGCGTACCCGCGTACCCGCCGTGTTGCATATCCGATGATCCGCCGTGCATGCTCAATATTCGTCAAATTCCTTGCGACCGGAACCTACCGGAACCTGCGTGATGTGGAGCTGTGGAGCTAATTTCGTGCCGGTTGC

Full Affymetrix probeset data:

Annotations for 1627587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720