FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627588_at:

>probe:Drosophila_2:1627588_at:413:347; Interrogation_Position=101; Antisense; GCATCGCAGAGGCTCAAGTTCCAGA
>probe:Drosophila_2:1627588_at:641:469; Interrogation_Position=118; Antisense; GTTCCAGATCAACCCGAGGCTATGG
>probe:Drosophila_2:1627588_at:337:161; Interrogation_Position=186; Antisense; ACAATTTGGAGCTCACGGCGGCGGA
>probe:Drosophila_2:1627588_at:298:131; Interrogation_Position=26; Antisense; ACCTGCATTGGAGTGGAACTGTACT
>probe:Drosophila_2:1627588_at:184:677; Interrogation_Position=312; Antisense; TAGACGCTAGGGACGTCTCTTATGT
>probe:Drosophila_2:1627588_at:350:471; Interrogation_Position=367; Antisense; GTTCTTACACTTACACTTGTGCATT
>probe:Drosophila_2:1627588_at:250:341; Interrogation_Position=430; Antisense; GCTTTAATTAATTACCGCTGCTTTG
>probe:Drosophila_2:1627588_at:626:163; Interrogation_Position=468; Antisense; AAATTTGTTTATCGCACACTCCGCA
>probe:Drosophila_2:1627588_at:213:699; Interrogation_Position=512; Antisense; TTTTTCCGGGAGCTCAGTGTCATAA
>probe:Drosophila_2:1627588_at:649:5; Interrogation_Position=536; Antisense; ATTGATTCGAAATAGCGGTGCTCCG
>probe:Drosophila_2:1627588_at:22:621; Interrogation_Position=554; Antisense; TGCTCCGCAACGTAATGGGTCACAC
>probe:Drosophila_2:1627588_at:478:297; Interrogation_Position=578; Antisense; CGCACTCGACACTCACTTTAAATAA
>probe:Drosophila_2:1627588_at:162:143; Interrogation_Position=60; Antisense; ACTGGCAATGTTGTCCTGGATTACT
>probe:Drosophila_2:1627588_at:315:13; Interrogation_Position=79; Antisense; ATTACTTGGGTGATGCTTCGGAGCA

Paste this into a BLAST search page for me
GCATCGCAGAGGCTCAAGTTCCAGAGTTCCAGATCAACCCGAGGCTATGGACAATTTGGAGCTCACGGCGGCGGAACCTGCATTGGAGTGGAACTGTACTTAGACGCTAGGGACGTCTCTTATGTGTTCTTACACTTACACTTGTGCATTGCTTTAATTAATTACCGCTGCTTTGAAATTTGTTTATCGCACACTCCGCATTTTTCCGGGAGCTCAGTGTCATAAATTGATTCGAAATAGCGGTGCTCCGTGCTCCGCAACGTAATGGGTCACACCGCACTCGACACTCACTTTAAATAAACTGGCAATGTTGTCCTGGATTACTATTACTTGGGTGATGCTTCGGAGCA

Full Affymetrix probeset data:

Annotations for 1627588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720