FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627590_at:

>probe:Drosophila_2:1627590_at:316:229; Interrogation_Position=116; Antisense; AATGGTGTCCGCTCTGAAATGCAGT
>probe:Drosophila_2:1627590_at:450:729; Interrogation_Position=141; Antisense; TTGGCCGTGGCCGTTATGATCAGTC
>probe:Drosophila_2:1627590_at:187:605; Interrogation_Position=157; Antisense; TGATCAGTCTGGCTTGTTCGGCCTA
>probe:Drosophila_2:1627590_at:141:33; Interrogation_Position=186; Antisense; ATCAAGTGCTACCAGTGCGAGTCCC
>probe:Drosophila_2:1627590_at:360:651; Interrogation_Position=211; Antisense; TCACAATGCCCAAGTGTGGCCTGAA
>probe:Drosophila_2:1627590_at:170:333; Interrogation_Position=243; Antisense; GCTGATGAGACGTTGCTGCTGGACT
>probe:Drosophila_2:1627590_at:297:623; Interrogation_Position=313; Antisense; TGCGGAACGCCACTGGTTGCATGAA
>probe:Drosophila_2:1627590_at:269:375; Interrogation_Position=338; Antisense; GAAGACCCTCGAAAGCGTGGCCGGA
>probe:Drosophila_2:1627590_at:681:557; Interrogation_Position=360; Antisense; GGACATCCGCAGATCGTGAGGAGCT
>probe:Drosophila_2:1627590_at:503:185; Interrogation_Position=402; Antisense; AACAATATCCAAGCTGGCTGCCAGT
>probe:Drosophila_2:1627590_at:506:279; Interrogation_Position=434; Antisense; CTCTATGCCGTTCGTTAAGCAGCTG
>probe:Drosophila_2:1627590_at:178:595; Interrogation_Position=457; Antisense; TGGGCTGCGATGTCTGCACCAAGGA
>probe:Drosophila_2:1627590_at:224:291; Interrogation_Position=549; Antisense; CGTCTGCTGGCCTAGATCTTAACTA
>probe:Drosophila_2:1627590_at:439:477; Interrogation_Position=596; Antisense; GTATTTAACGATCTTGTTCTCTGGA

Paste this into a BLAST search page for me
AATGGTGTCCGCTCTGAAATGCAGTTTGGCCGTGGCCGTTATGATCAGTCTGATCAGTCTGGCTTGTTCGGCCTAATCAAGTGCTACCAGTGCGAGTCCCTCACAATGCCCAAGTGTGGCCTGAAGCTGATGAGACGTTGCTGCTGGACTTGCGGAACGCCACTGGTTGCATGAAGAAGACCCTCGAAAGCGTGGCCGGAGGACATCCGCAGATCGTGAGGAGCTAACAATATCCAAGCTGGCTGCCAGTCTCTATGCCGTTCGTTAAGCAGCTGTGGGCTGCGATGTCTGCACCAAGGACGTCTGCTGGCCTAGATCTTAACTAGTATTTAACGATCTTGTTCTCTGGA

Full Affymetrix probeset data:

Annotations for 1627590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720