Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627592_at:

>probe:Drosophila_2:1627592_at:226:349; Interrogation_Position=1281; Antisense; GCAGGTGATGCAGTCGCGCCAAGTC
>probe:Drosophila_2:1627592_at:642:85; Interrogation_Position=1302; Antisense; AGTCCTTGGCATGTGGAACGGCTGC
>probe:Drosophila_2:1627592_at:561:281; Interrogation_Position=1323; Antisense; CTGCGACGAGTTGCCCATTGAGATC
>probe:Drosophila_2:1627592_at:580:725; Interrogation_Position=1340; Antisense; TTGAGATCGATCTGCAGCCGGAATT
>probe:Drosophila_2:1627592_at:567:689; Interrogation_Position=1394; Antisense; TATTGCGCCAGCAGACTTCCGAGGA
>probe:Drosophila_2:1627592_at:398:233; Interrogation_Position=1419; Antisense; CAATCCGCCGAAGAAGTTGACCTGC
>probe:Drosophila_2:1627592_at:603:609; Interrogation_Position=1436; Antisense; TGACCTGCGGTCATGTCATATCCAA
>probe:Drosophila_2:1627592_at:211:411; Interrogation_Position=1462; Antisense; GACGCCCTGCACAAGCTGAGTGTTG
>probe:Drosophila_2:1627592_at:698:727; Interrogation_Position=1484; Antisense; TTGGCCACATACTGAAGTGCCCCTA
>probe:Drosophila_2:1627592_at:614:437; Interrogation_Position=1534; Antisense; GAGGCTGTTCGCATCTACTTTTAAG
>probe:Drosophila_2:1627592_at:183:313; Interrogation_Position=1558; Antisense; GCCACATCTATGTATTCACCTTATG
>probe:Drosophila_2:1627592_at:39:23; Interrogation_Position=1599; Antisense; ATATGACCAGGCTCAGGCGGTTCGA
>probe:Drosophila_2:1627592_at:309:103; Interrogation_Position=1712; Antisense; AGAGCGGAATCGAACTGCCTGGGCC
>probe:Drosophila_2:1627592_at:668:597; Interrogation_Position=1751; Antisense; TGTCCCACTTCCTAACAAACGATTT

Paste this into a BLAST search page for me
GCAGGTGATGCAGTCGCGCCAAGTCAGTCCTTGGCATGTGGAACGGCTGCCTGCGACGAGTTGCCCATTGAGATCTTGAGATCGATCTGCAGCCGGAATTTATTGCGCCAGCAGACTTCCGAGGACAATCCGCCGAAGAAGTTGACCTGCTGACCTGCGGTCATGTCATATCCAAGACGCCCTGCACAAGCTGAGTGTTGTTGGCCACATACTGAAGTGCCCCTAGAGGCTGTTCGCATCTACTTTTAAGGCCACATCTATGTATTCACCTTATGATATGACCAGGCTCAGGCGGTTCGAAGAGCGGAATCGAACTGCCTGGGCCTGTCCCACTTCCTAACAAACGATTT

Full Affymetrix probeset data:

Annotations for 1627592_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime