Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627593_at:

>probe:Drosophila_2:1627593_at:725:105; Interrogation_Position=1231; Antisense; AGAACACCTTCAATGGCACGTGCAG
>probe:Drosophila_2:1627593_at:28:511; Interrogation_Position=1250; Antisense; GTGCAGCATTCCACCTATGCTAAAG
>probe:Drosophila_2:1627593_at:149:205; Interrogation_Position=1272; Antisense; AAGCCGAAACCGATATGCGATATTT
>probe:Drosophila_2:1627593_at:571:679; Interrogation_Position=1313; Antisense; TAGTGTCTACGCCTTGAAGCGGCAT
>probe:Drosophila_2:1627593_at:578:377; Interrogation_Position=1328; Antisense; GAAGCGGCATATGCTTACTCACAAT
>probe:Drosophila_2:1627593_at:703:279; Interrogation_Position=1345; Antisense; CTCACAATCGCCAACATCATCTTAA
>probe:Drosophila_2:1627593_at:541:487; Interrogation_Position=1375; Antisense; GTACCTATTGTTCCGAGGAGTTCAA
>probe:Drosophila_2:1627593_at:103:539; Interrogation_Position=1431; Antisense; GGTCACATGGGAGATCTGTTTCGTT
>probe:Drosophila_2:1627593_at:596:717; Interrogation_Position=1450; Antisense; TTCGTTGCGAATTTTGCTCATTGGT
>probe:Drosophila_2:1627593_at:448:443; Interrogation_Position=1482; Antisense; GATGTTAACTACTTGCGAAAGCACA
>probe:Drosophila_2:1627593_at:644:453; Interrogation_Position=1550; Antisense; GATCATGTCCAAACGGGTGACTACC
>probe:Drosophila_2:1627593_at:208:533; Interrogation_Position=1565; Antisense; GGTGACTACCGGTTATACTCTTGGA
>probe:Drosophila_2:1627593_at:192:607; Interrogation_Position=1664; Antisense; TGACCGCAGGTCTAAACTTCTGTTG
>probe:Drosophila_2:1627593_at:106:149; Interrogation_Position=1679; Antisense; ACTTCTGTTGTTGATTCTTACTTTG

Paste this into a BLAST search page for me
AGAACACCTTCAATGGCACGTGCAGGTGCAGCATTCCACCTATGCTAAAGAAGCCGAAACCGATATGCGATATTTTAGTGTCTACGCCTTGAAGCGGCATGAAGCGGCATATGCTTACTCACAATCTCACAATCGCCAACATCATCTTAAGTACCTATTGTTCCGAGGAGTTCAAGGTCACATGGGAGATCTGTTTCGTTTTCGTTGCGAATTTTGCTCATTGGTGATGTTAACTACTTGCGAAAGCACAGATCATGTCCAAACGGGTGACTACCGGTGACTACCGGTTATACTCTTGGATGACCGCAGGTCTAAACTTCTGTTGACTTCTGTTGTTGATTCTTACTTTG

Full Affymetrix probeset data:

Annotations for 1627593_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime