FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627595_at:

>probe:Drosophila_2:1627595_at:62:711; Interrogation_Position=103; Antisense; TTCCGCCGAGGTGGTCAACTTCGAA
>probe:Drosophila_2:1627595_at:179:495; Interrogation_Position=116; Antisense; GTCAACTTCGAACCATGTCCGGATA
>probe:Drosophila_2:1627595_at:3:505; Interrogation_Position=132; Antisense; GTCCGGATAGCGTAGACACCTGTAC
>probe:Drosophila_2:1627595_at:510:447; Interrogation_Position=157; Antisense; GATCCAGCAGGTGAGAGTCTCGCCA
>probe:Drosophila_2:1627595_at:5:549; Interrogation_Position=187; Antisense; GGAGGCCCTCAACAATGCGGCTTGC
>probe:Drosophila_2:1627595_at:40:53; Interrogation_Position=201; Antisense; ATGCGGCTTGCAATATCCGCCGGAA
>probe:Drosophila_2:1627595_at:408:607; Interrogation_Position=235; Antisense; TGAGATGAGCTTCGACTTCACGCCG
>probe:Drosophila_2:1627595_at:482:97; Interrogation_Position=374; Antisense; AGATCCGGAGTGAAACAGACCTACA
>probe:Drosophila_2:1627595_at:255:41; Interrogation_Position=413; Antisense; ATCGAGGCCAAGTTTCCCCTGAGTC
>probe:Drosophila_2:1627595_at:194:615; Interrogation_Position=459; Antisense; TGAAGGATCCCGTCTCCCAGAAGCG
>probe:Drosophila_2:1627595_at:25:223; Interrogation_Position=506; Antisense; AAGGTGGTGCGCTGATTTGTGCCCA
>probe:Drosophila_2:1627595_at:496:321; Interrogation_Position=526; Antisense; GCCCACGCTGCATGAGCACTAAATT
>probe:Drosophila_2:1627595_at:195:225; Interrogation_Position=630; Antisense; AAGGAGCTATATTGGCTGCTCCCCT
>probe:Drosophila_2:1627595_at:725:619; Interrogation_Position=646; Antisense; TGCTCCCCTGATTGTGGCGAATGCA

Paste this into a BLAST search page for me
TTCCGCCGAGGTGGTCAACTTCGAAGTCAACTTCGAACCATGTCCGGATAGTCCGGATAGCGTAGACACCTGTACGATCCAGCAGGTGAGAGTCTCGCCAGGAGGCCCTCAACAATGCGGCTTGCATGCGGCTTGCAATATCCGCCGGAATGAGATGAGCTTCGACTTCACGCCGAGATCCGGAGTGAAACAGACCTACAATCGAGGCCAAGTTTCCCCTGAGTCTGAAGGATCCCGTCTCCCAGAAGCGAAGGTGGTGCGCTGATTTGTGCCCAGCCCACGCTGCATGAGCACTAAATTAAGGAGCTATATTGGCTGCTCCCCTTGCTCCCCTGATTGTGGCGAATGCA

Full Affymetrix probeset data:

Annotations for 1627595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720