FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627597_at:

>probe:Drosophila_2:1627597_at:21:101; Interrogation_Position=373; Antisense; AGAGGATGTGGTGCCTTCACTAGCT
>probe:Drosophila_2:1627597_at:295:511; Interrogation_Position=413; Antisense; GTGAGCGATCTCATGTCAATGGGAT
>probe:Drosophila_2:1627597_at:174:325; Interrogation_Position=441; Antisense; GCGAAGAGGAGGTACGCTCAGCCCT
>probe:Drosophila_2:1627597_at:129:523; Interrogation_Position=468; Antisense; GGGCGAGCTTTAATCATCCGGAAAG
>probe:Drosophila_2:1627597_at:687:7; Interrogation_Position=518; Antisense; ATTCCTCAGGAGGTTGTTTCAGAGC
>probe:Drosophila_2:1627597_at:246:13; Interrogation_Position=547; Antisense; ATTAGCTGCAATCCCGAGCGTACAG
>probe:Drosophila_2:1627597_at:569:103; Interrogation_Position=671; Antisense; AGACTGGCTGAAACCGATCCGGCTA
>probe:Drosophila_2:1627597_at:496:339; Interrogation_Position=692; Antisense; GCTACCTTCGAAGTCTTTCAGCGTA
>probe:Drosophila_2:1627597_at:461:385; Interrogation_Position=733; Antisense; GAACATGATTTCAGGCGGCGCAAGT
>probe:Drosophila_2:1627597_at:55:503; Interrogation_Position=756; Antisense; GTCGCACCCCGAACGAGATTGAACA
>probe:Drosophila_2:1627597_at:593:665; Interrogation_Position=783; Antisense; TACAGATTACTTTAACCGCCGAAGA
>probe:Drosophila_2:1627597_at:398:689; Interrogation_Position=826; Antisense; TTTGGAGGCACTGGGTTTCGAACGT
>probe:Drosophila_2:1627597_at:152:685; Interrogation_Position=869; Antisense; TATCTGGCCTGCGACAAGGACGAGC
>probe:Drosophila_2:1627597_at:621:113; Interrogation_Position=891; Antisense; AGCAGCTGGCCGCAGAGGTACTAAT

Paste this into a BLAST search page for me
AGAGGATGTGGTGCCTTCACTAGCTGTGAGCGATCTCATGTCAATGGGATGCGAAGAGGAGGTACGCTCAGCCCTGGGCGAGCTTTAATCATCCGGAAAGATTCCTCAGGAGGTTGTTTCAGAGCATTAGCTGCAATCCCGAGCGTACAGAGACTGGCTGAAACCGATCCGGCTAGCTACCTTCGAAGTCTTTCAGCGTAGAACATGATTTCAGGCGGCGCAAGTGTCGCACCCCGAACGAGATTGAACATACAGATTACTTTAACCGCCGAAGATTTGGAGGCACTGGGTTTCGAACGTTATCTGGCCTGCGACAAGGACGAGCAGCAGCTGGCCGCAGAGGTACTAAT

Full Affymetrix probeset data:

Annotations for 1627597_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720