FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627598_at:

>probe:Drosophila_2:1627598_at:704:89; Interrogation_Position=2333; Antisense; AGTATGCGCAAATTACGCTGCCCTT
>probe:Drosophila_2:1627598_at:554:335; Interrogation_Position=2349; Antisense; GCTGCCCTTCAAGATGGTTGCCTAA
>probe:Drosophila_2:1627598_at:181:537; Interrogation_Position=2389; Antisense; GGTTGCAAACTGTGGGTCGTATCTA
>probe:Drosophila_2:1627598_at:340:237; Interrogation_Position=2464; Antisense; AATCTGACTGTTTCTCCGTGTTTAA
>probe:Drosophila_2:1627598_at:593:89; Interrogation_Position=2481; Antisense; GTGTTTAACACGAGTCGCCCGTAAG
>probe:Drosophila_2:1627598_at:679:707; Interrogation_Position=2573; Antisense; TTAAAGTTTACTCTCGCATCGAAGC
>probe:Drosophila_2:1627598_at:199:269; Interrogation_Position=2589; Antisense; CATCGAAGCTAAGCGAGGCGGGCCA
>probe:Drosophila_2:1627598_at:90:331; Interrogation_Position=2606; Antisense; GCGGGCCAAGCGGATACACTGATTT
>probe:Drosophila_2:1627598_at:139:701; Interrogation_Position=2667; Antisense; TTATTGTAAGTTCTCTTCCTCACCT
>probe:Drosophila_2:1627598_at:292:181; Interrogation_Position=2699; Antisense; AAAACACCCTCATCCTATATTCGAT
>probe:Drosophila_2:1627598_at:101:271; Interrogation_Position=2709; Antisense; CATCCTATATTCGATCACCTCTAAT
>probe:Drosophila_2:1627598_at:625:105; Interrogation_Position=2741; Antisense; AGAAATTAGTTCTCGTGCCTGTGAA
>probe:Drosophila_2:1627598_at:326:79; Interrogation_Position=2779; Antisense; AGGTATCACTTTGCTTTATCGGACT
>probe:Drosophila_2:1627598_at:541:703; Interrogation_Position=2794; Antisense; TTATCGGACTTCAACACGCCTGTCT

Paste this into a BLAST search page for me
AGTATGCGCAAATTACGCTGCCCTTGCTGCCCTTCAAGATGGTTGCCTAAGGTTGCAAACTGTGGGTCGTATCTAAATCTGACTGTTTCTCCGTGTTTAAGTGTTTAACACGAGTCGCCCGTAAGTTAAAGTTTACTCTCGCATCGAAGCCATCGAAGCTAAGCGAGGCGGGCCAGCGGGCCAAGCGGATACACTGATTTTTATTGTAAGTTCTCTTCCTCACCTAAAACACCCTCATCCTATATTCGATCATCCTATATTCGATCACCTCTAATAGAAATTAGTTCTCGTGCCTGTGAAAGGTATCACTTTGCTTTATCGGACTTTATCGGACTTCAACACGCCTGTCT

Full Affymetrix probeset data:

Annotations for 1627598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720