FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627599_at:

>probe:Drosophila_2:1627599_at:10:11; Interrogation_Position=5133; Antisense; ATTACTTGCTGATTGATTAACTTAA
>probe:Drosophila_2:1627599_at:115:483; Interrogation_Position=5161; Antisense; GTATCTAGTTGAACACACAATCTGG
>probe:Drosophila_2:1627599_at:540:257; Interrogation_Position=5176; Antisense; CACAATCTGGATAACGGGCTATAAT
>probe:Drosophila_2:1627599_at:585:493; Interrogation_Position=5206; Antisense; GTAATTTGGTGGTGCTTCATATTTT
>probe:Drosophila_2:1627599_at:101:85; Interrogation_Position=5247; Antisense; AGTTTCTGTGGCTGCGGTTGACCTA
>probe:Drosophila_2:1627599_at:16:287; Interrogation_Position=5257; Antisense; GCTGCGGTTGACCTAGAGGTTCTAC
>probe:Drosophila_2:1627599_at:695:435; Interrogation_Position=5272; Antisense; GAGGTTCTACATTAATTTATCTGAG
>probe:Drosophila_2:1627599_at:193:713; Interrogation_Position=5343; Antisense; TTCACAATCATTCACAAACACCCAT
>probe:Drosophila_2:1627599_at:470:491; Interrogation_Position=5388; Antisense; GTAAATCACACAAAAAATCGCCTAA
>probe:Drosophila_2:1627599_at:177:631; Interrogation_Position=5405; Antisense; TCGCCTAACCTACACATTTTCATAT
>probe:Drosophila_2:1627599_at:107:17; Interrogation_Position=5420; Antisense; ATTTTCATATGCTTCTACTCCTGCA
>probe:Drosophila_2:1627599_at:480:603; Interrogation_Position=5429; Antisense; TGCTTCTACTCCTGCAAACGAATTG
>probe:Drosophila_2:1627599_at:153:397; Interrogation_Position=5453; Antisense; GAAATTGAAAAACTCGAATCCGATC
>probe:Drosophila_2:1627599_at:568:635; Interrogation_Position=5466; Antisense; TCGAATCCGATCAAAAACACCGCAA

Paste this into a BLAST search page for me
ATTACTTGCTGATTGATTAACTTAAGTATCTAGTTGAACACACAATCTGGCACAATCTGGATAACGGGCTATAATGTAATTTGGTGGTGCTTCATATTTTAGTTTCTGTGGCTGCGGTTGACCTAGCTGCGGTTGACCTAGAGGTTCTACGAGGTTCTACATTAATTTATCTGAGTTCACAATCATTCACAAACACCCATGTAAATCACACAAAAAATCGCCTAATCGCCTAACCTACACATTTTCATATATTTTCATATGCTTCTACTCCTGCATGCTTCTACTCCTGCAAACGAATTGGAAATTGAAAAACTCGAATCCGATCTCGAATCCGATCAAAAACACCGCAA

Full Affymetrix probeset data:

Annotations for 1627599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720