Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627600_at:

>probe:Drosophila_2:1627600_at:496:547; Interrogation_Position=1031; Antisense; GGATGATTATGTTTCCCAACTTCAA
>probe:Drosophila_2:1627600_at:85:533; Interrogation_Position=1061; Antisense; GGTGCAGTGCTTTTAACCACGAGTT
>probe:Drosophila_2:1627600_at:532:287; Interrogation_Position=1080; Antisense; CGAGTTGGCTGTATGGGTTCTTCAC
>probe:Drosophila_2:1627600_at:493:657; Interrogation_Position=1121; Antisense; TAATGGATCTGCAAACCCTGCTGTT
>probe:Drosophila_2:1627600_at:392:211; Interrogation_Position=1180; Antisense; AAGAAATTCCGACAGGCTTGCCTAG
>probe:Drosophila_2:1627600_at:14:71; Interrogation_Position=1193; Antisense; AGGCTTGCCTAGCAGGTAGCTTTTT
>probe:Drosophila_2:1627600_at:367:161; Interrogation_Position=1244; Antisense; ACAAGAGCCGTTTCTATTTCAAGGA
>probe:Drosophila_2:1627600_at:197:45; Interrogation_Position=1289; Antisense; ATCCCACTCTCTACTGGAATCTGGA
>probe:Drosophila_2:1627600_at:295:507; Interrogation_Position=1336; Antisense; GTGCGGCGTCACATGATTGGGATCA
>probe:Drosophila_2:1627600_at:536:593; Interrogation_Position=1353; Antisense; TGGGATCAACAAGTACCTGCACCGC
>probe:Drosophila_2:1627600_at:354:325; Interrogation_Position=1376; Antisense; GCGAGAAGTTCACCGTTGACTCAAA
>probe:Drosophila_2:1627600_at:229:117; Interrogation_Position=928; Antisense; AGCTTGAGCATCTGTAACGCCACTT
>probe:Drosophila_2:1627600_at:492:131; Interrogation_Position=973; Antisense; ACCTGGCAGCATCTTGGCGAGCTAA
>probe:Drosophila_2:1627600_at:321:231; Interrogation_Position=999; Antisense; AATGAAGTGGTCTCGTATCTATCCC

Paste this into a BLAST search page for me
GGATGATTATGTTTCCCAACTTCAAGGTGCAGTGCTTTTAACCACGAGTTCGAGTTGGCTGTATGGGTTCTTCACTAATGGATCTGCAAACCCTGCTGTTAAGAAATTCCGACAGGCTTGCCTAGAGGCTTGCCTAGCAGGTAGCTTTTTACAAGAGCCGTTTCTATTTCAAGGAATCCCACTCTCTACTGGAATCTGGAGTGCGGCGTCACATGATTGGGATCATGGGATCAACAAGTACCTGCACCGCGCGAGAAGTTCACCGTTGACTCAAAAGCTTGAGCATCTGTAACGCCACTTACCTGGCAGCATCTTGGCGAGCTAAAATGAAGTGGTCTCGTATCTATCCC

Full Affymetrix probeset data:

Annotations for 1627600_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime