FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627601_at:

>probe:Drosophila_2:1627601_at:687:249; Interrogation_Position=115; Antisense; CAAGTTAATCCGGTTATCGCTGCAG
>probe:Drosophila_2:1627601_at:189:475; Interrogation_Position=118; Antisense; GTTAATCCGGTTATCGCTGCAGAGT
>probe:Drosophila_2:1627601_at:186:47; Interrogation_Position=122; Antisense; ATCCGGTTATCGCTGCAGAGTTTAG
>probe:Drosophila_2:1627601_at:71:703; Interrogation_Position=128; Antisense; TTATCGCTGCAGAGTTTAGCCCGAA
>probe:Drosophila_2:1627601_at:40:59; Interrogation_Position=13; Antisense; ATGTTAACGGACATGACACCGACCG
>probe:Drosophila_2:1627601_at:501:283; Interrogation_Position=134; Antisense; CTGCAGAGTTTAGCCCGAAAGTATC
>probe:Drosophila_2:1627601_at:346:477; Interrogation_Position=141; Antisense; GTTTAGCCCGAAAGTATCTCATAGA
>probe:Drosophila_2:1627601_at:325:95; Interrogation_Position=163; Antisense; AGATACATATGTGGGCTCACTGCGC
>probe:Drosophila_2:1627601_at:568:151; Interrogation_Position=167; Antisense; ACATATGTGGGCTCACTGCGCACAA
>probe:Drosophila_2:1627601_at:309:63; Interrogation_Position=171; Antisense; ATGTGGGCTCACTGCGCACAAGTGA
>probe:Drosophila_2:1627601_at:525:623; Interrogation_Position=183; Antisense; TGCGCACAAGTGACTGGCAGGCATT
>probe:Drosophila_2:1627601_at:536:511; Interrogation_Position=192; Antisense; GTGACTGGCAGGCATTTGCTGACTT
>probe:Drosophila_2:1627601_at:244:347; Interrogation_Position=199; Antisense; GCAGGCATTTGCTGACTTAGTCATG
>probe:Drosophila_2:1627601_at:471:345; Interrogation_Position=203; Antisense; GCATTTGCTGACTTAGTCATGATTT

Paste this into a BLAST search page for me
CAAGTTAATCCGGTTATCGCTGCAGGTTAATCCGGTTATCGCTGCAGAGTATCCGGTTATCGCTGCAGAGTTTAGTTATCGCTGCAGAGTTTAGCCCGAAATGTTAACGGACATGACACCGACCGCTGCAGAGTTTAGCCCGAAAGTATCGTTTAGCCCGAAAGTATCTCATAGAAGATACATATGTGGGCTCACTGCGCACATATGTGGGCTCACTGCGCACAAATGTGGGCTCACTGCGCACAAGTGATGCGCACAAGTGACTGGCAGGCATTGTGACTGGCAGGCATTTGCTGACTTGCAGGCATTTGCTGACTTAGTCATGGCATTTGCTGACTTAGTCATGATTT

Full Affymetrix probeset data:

Annotations for 1627601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720