FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627602_at:

>probe:Drosophila_2:1627602_at:555:101; Interrogation_Position=3158; Antisense; AACAGGAAAAAGAGTTCAACATGGT
>probe:Drosophila_2:1627602_at:174:51; Interrogation_Position=3200; Antisense; ATGCTCGTAACATTGCCGCCAATAA
>probe:Drosophila_2:1627602_at:63:339; Interrogation_Position=3202; Antisense; GCTCGTAACATTGCCGCCAATAATC
>probe:Drosophila_2:1627602_at:237:9; Interrogation_Position=3211; Antisense; ATTGCCGCCAATAATCATCATTTGC
>probe:Drosophila_2:1627602_at:457:35; Interrogation_Position=3227; Antisense; ATCATTTGCACAATCGCAGTACGGG
>probe:Drosophila_2:1627602_at:631:693; Interrogation_Position=3231; Antisense; TTTGCACAATCGCAGTACGGGCTCA
>probe:Drosophila_2:1627602_at:288:617; Interrogation_Position=3233; Antisense; TGCACAATCGCAGTACGGGCTCAAT
>probe:Drosophila_2:1627602_at:223:257; Interrogation_Position=3235; Antisense; CACAATCGCAGTACGGGCTCAATTT
>probe:Drosophila_2:1627602_at:364:341; Interrogation_Position=3242; Antisense; GCAGTACGGGCTCAATTTCCTCTGG
>probe:Drosophila_2:1627602_at:488:669; Interrogation_Position=3246; Antisense; TACGGGCTCAATTTCCTCTGGTCAA
>probe:Drosophila_2:1627602_at:233:571; Interrogation_Position=3250; Antisense; GGCTCAATTTCCTCTGGTCAAGTGC
>probe:Drosophila_2:1627602_at:662:653; Interrogation_Position=3253; Antisense; TCAATTTCCTCTGGTCAAGTGCCTT
>probe:Drosophila_2:1627602_at:159:19; Interrogation_Position=3256; Antisense; ATTTCCTCTGGTCAAGTGCCTTTAA
>probe:Drosophila_2:1627602_at:207:629; Interrogation_Position=3259; Antisense; TCCTCTGGTCAAGTGCCTTTAAAAA

Paste this into a BLAST search page for me
AACAGGAAAAAGAGTTCAACATGGTATGCTCGTAACATTGCCGCCAATAAGCTCGTAACATTGCCGCCAATAATCATTGCCGCCAATAATCATCATTTGCATCATTTGCACAATCGCAGTACGGGTTTGCACAATCGCAGTACGGGCTCATGCACAATCGCAGTACGGGCTCAATCACAATCGCAGTACGGGCTCAATTTGCAGTACGGGCTCAATTTCCTCTGGTACGGGCTCAATTTCCTCTGGTCAAGGCTCAATTTCCTCTGGTCAAGTGCTCAATTTCCTCTGGTCAAGTGCCTTATTTCCTCTGGTCAAGTGCCTTTAATCCTCTGGTCAAGTGCCTTTAAAAA

Full Affymetrix probeset data:

Annotations for 1627602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720