Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627603_at:

>probe:Drosophila_2:1627603_at:17:439; Interrogation_Position=1366; Antisense; GAGGCTCAAGCATGCTACCAACTGG
>probe:Drosophila_2:1627603_at:444:195; Interrogation_Position=1385; Antisense; AACTGGTGCCCAATCGCCGCGGTGG
>probe:Drosophila_2:1627603_at:612:319; Interrogation_Position=1400; Antisense; GCCGCGGTGGGAAGAACCTCATCTT
>probe:Drosophila_2:1627603_at:457:567; Interrogation_Position=1430; Antisense; GGCACATGTACTCCGTGGAGCGCAA
>probe:Drosophila_2:1627603_at:218:587; Interrogation_Position=1445; Antisense; TGGAGCGCAAGTACCGAAACAGCAT
>probe:Drosophila_2:1627603_at:323:189; Interrogation_Position=1462; Antisense; AACAGCATCAACTGGGTATGTTCCA
>probe:Drosophila_2:1627603_at:590:211; Interrogation_Position=1486; Antisense; AAGAACAGCAACAGCGTGCTTCGCT
>probe:Drosophila_2:1627603_at:208:337; Interrogation_Position=1508; Antisense; GCTGCCCGGCGAGGTGCGTCACAAA
>probe:Drosophila_2:1627603_at:325:435; Interrogation_Position=1518; Antisense; GAGGTGCGTCACAAATCCGGAGAGT
>probe:Drosophila_2:1627603_at:204:167; Interrogation_Position=1530; Antisense; AAATCCGGAGAGTGGCAATGGCATC
>probe:Drosophila_2:1627603_at:114:227; Interrogation_Position=1546; Antisense; AATGGCATCAAGCTGAGCCACCGAC
>probe:Drosophila_2:1627603_at:146:37; Interrogation_Position=1577; Antisense; ATCATCCGGCGGATGCCTTTAAGCC
>probe:Drosophila_2:1627603_at:141:711; Interrogation_Position=1595; Antisense; TTAAGCCCCACAAGCGCTGTCGAAA
>probe:Drosophila_2:1627603_at:481:597; Interrogation_Position=1612; Antisense; TGTCGAAAGCGTCCCGGCGATCGAA

Paste this into a BLAST search page for me
GAGGCTCAAGCATGCTACCAACTGGAACTGGTGCCCAATCGCCGCGGTGGGCCGCGGTGGGAAGAACCTCATCTTGGCACATGTACTCCGTGGAGCGCAATGGAGCGCAAGTACCGAAACAGCATAACAGCATCAACTGGGTATGTTCCAAAGAACAGCAACAGCGTGCTTCGCTGCTGCCCGGCGAGGTGCGTCACAAAGAGGTGCGTCACAAATCCGGAGAGTAAATCCGGAGAGTGGCAATGGCATCAATGGCATCAAGCTGAGCCACCGACATCATCCGGCGGATGCCTTTAAGCCTTAAGCCCCACAAGCGCTGTCGAAATGTCGAAAGCGTCCCGGCGATCGAA

Full Affymetrix probeset data:

Annotations for 1627603_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime