FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627604_at:

>probe:Drosophila_2:1627604_at:325:193; Interrogation_Position=125; Antisense; AACTAACCGAGCGACTGGCAAAGAT
>probe:Drosophila_2:1627604_at:718:659; Interrogation_Position=128; Antisense; TAACCGAGCGACTGGCAAAGATAGC
>probe:Drosophila_2:1627604_at:629:323; Interrogation_Position=135; Antisense; GCGACTGGCAAAGATAGCCGGCCTA
>probe:Drosophila_2:1627604_at:310:407; Interrogation_Position=137; Antisense; GACTGGCAAAGATAGCCGGCCTAAA
>probe:Drosophila_2:1627604_at:34:449; Interrogation_Position=147; Antisense; GATAGCCGGCCTAAACCGCCTAAAG
>probe:Drosophila_2:1627604_at:37:317; Interrogation_Position=155; Antisense; GCCTAAACCGCCTAAAGACAGATGG
>probe:Drosophila_2:1627604_at:527:301; Interrogation_Position=162; Antisense; CCGCCTAAAGACAGATGGTGATCCA
>probe:Drosophila_2:1627604_at:536:105; Interrogation_Position=170; Antisense; AGACAGATGGTGATCCAGGACAAAC
>probe:Drosophila_2:1627604_at:369:267; Interrogation_Position=185; Antisense; CAGGACAAACGGGATCGGGCAGTCT
>probe:Drosophila_2:1627604_at:122:41; Interrogation_Position=198; Antisense; ATCGGGCAGTCTGTCTGGCAGTCGA
>probe:Drosophila_2:1627604_at:292:569; Interrogation_Position=202; Antisense; GGCAGTCTGTCTGGCAGTCGAATGA
>probe:Drosophila_2:1627604_at:13:643; Interrogation_Position=207; Antisense; TCTGTCTGGCAGTCGAATGAACTCC
>probe:Drosophila_2:1627604_at:589:499; Interrogation_Position=210; Antisense; GTCTGGCAGTCGAATGAACTCCATT
>probe:Drosophila_2:1627604_at:194:583; Interrogation_Position=213; Antisense; TGGCAGTCGAATGAACTCCATTCCG

Paste this into a BLAST search page for me
AACTAACCGAGCGACTGGCAAAGATTAACCGAGCGACTGGCAAAGATAGCGCGACTGGCAAAGATAGCCGGCCTAGACTGGCAAAGATAGCCGGCCTAAAGATAGCCGGCCTAAACCGCCTAAAGGCCTAAACCGCCTAAAGACAGATGGCCGCCTAAAGACAGATGGTGATCCAAGACAGATGGTGATCCAGGACAAACCAGGACAAACGGGATCGGGCAGTCTATCGGGCAGTCTGTCTGGCAGTCGAGGCAGTCTGTCTGGCAGTCGAATGATCTGTCTGGCAGTCGAATGAACTCCGTCTGGCAGTCGAATGAACTCCATTTGGCAGTCGAATGAACTCCATTCCG

Full Affymetrix probeset data:

Annotations for 1627604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720