FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627605_at:

>probe:Drosophila_2:1627605_at:435:77; Interrogation_Position=1041; Antisense; AGGATGGTAACGCTCCAGCATGCGC
>probe:Drosophila_2:1627605_at:167:513; Interrogation_Position=1073; Antisense; GTGATCACCGACGAGCACGGTTACT
>probe:Drosophila_2:1627605_at:447:473; Interrogation_Position=1092; Antisense; GTTACTCGTGCAATCCCGGGATGAA
>probe:Drosophila_2:1627605_at:470:295; Interrogation_Position=1141; Antisense; CGAGCTGACGGCCAAGATAATCTTC
>probe:Drosophila_2:1627605_at:434:185; Interrogation_Position=1167; Antisense; AAAATTATCTGTCCGGTCATTCGCT
>probe:Drosophila_2:1627605_at:499:287; Interrogation_Position=1193; Antisense; CGGCGATTTTATCCCGATGATCCGA
>probe:Drosophila_2:1627605_at:510:365; Interrogation_Position=1216; Antisense; GAATCTAGAAAACCCGCCGCTGCTG
>probe:Drosophila_2:1627605_at:616:617; Interrogation_Position=1239; Antisense; TGCAGCTGAATCCTCCGCAGGAAGA
>probe:Drosophila_2:1627605_at:161:121; Interrogation_Position=1302; Antisense; AGCTGTTTGATGTTCAGTGCTCCTA
>probe:Drosophila_2:1627605_at:615:403; Interrogation_Position=1353; Antisense; GACTATAGCTACACTGCAACTGGCC
>probe:Drosophila_2:1627605_at:424:253; Interrogation_Position=1369; Antisense; CAACTGGCCGCGTGCATTGTGCAAA
>probe:Drosophila_2:1627605_at:84:403; Interrogation_Position=923; Antisense; GACATTCGCCTGGTGACGAACCAAG
>probe:Drosophila_2:1627605_at:216:431; Interrogation_Position=952; Antisense; GAGTACTACAAATCCGCACGATGTG
>probe:Drosophila_2:1627605_at:226:65; Interrogation_Position=978; Antisense; ATGGGTTCTTTGACTATCACCGTCT

Paste this into a BLAST search page for me
AGGATGGTAACGCTCCAGCATGCGCGTGATCACCGACGAGCACGGTTACTGTTACTCGTGCAATCCCGGGATGAACGAGCTGACGGCCAAGATAATCTTCAAAATTATCTGTCCGGTCATTCGCTCGGCGATTTTATCCCGATGATCCGAGAATCTAGAAAACCCGCCGCTGCTGTGCAGCTGAATCCTCCGCAGGAAGAAGCTGTTTGATGTTCAGTGCTCCTAGACTATAGCTACACTGCAACTGGCCCAACTGGCCGCGTGCATTGTGCAAAGACATTCGCCTGGTGACGAACCAAGGAGTACTACAAATCCGCACGATGTGATGGGTTCTTTGACTATCACCGTCT

Full Affymetrix probeset data:

Annotations for 1627605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720