Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627608_s_at:

>probe:Drosophila_2:1627608_s_at:339:365; Interrogation_Position=105; Antisense; GAATCAACCGACACAGATTCAGATA
>probe:Drosophila_2:1627608_s_at:193:463; Interrogation_Position=120; Antisense; GATTCAGATACAGGGCCATCAGCAA
>probe:Drosophila_2:1627608_s_at:698:55; Interrogation_Position=13; Antisense; ATGAGCCAACTCGAAGGCAGCCAGC
>probe:Drosophila_2:1627608_s_at:492:187; Interrogation_Position=143; Antisense; AACAGCATCCAAGCAGCCAAAATCA
>probe:Drosophila_2:1627608_s_at:25:241; Interrogation_Position=163; Antisense; AATCAACAGCCAAAGCGTCGGCCAA
>probe:Drosophila_2:1627608_s_at:243:207; Interrogation_Position=175; Antisense; AAGCGTCGGCCAAGTGGCGTTTTAT
>probe:Drosophila_2:1627608_s_at:644:309; Interrogation_Position=184; Antisense; CCAAGTGGCGTTTTATGGCAATTGC
>probe:Drosophila_2:1627608_s_at:381:585; Interrogation_Position=199; Antisense; TGGCAATTGCGCCATCAGCTGCAAA
>probe:Drosophila_2:1627608_s_at:302:723; Interrogation_Position=205; Antisense; TTGCGCCATCAGCTGCAAAAGCGTA
>probe:Drosophila_2:1627608_s_at:427:351; Interrogation_Position=230; Antisense; GCACGAGGAAGATGAAAACCATTTC
>probe:Drosophila_2:1627608_s_at:168:227; Interrogation_Position=26; Antisense; AAGGCAGCCAGCAGAATACGAAACT
>probe:Drosophila_2:1627608_s_at:248:391; Interrogation_Position=45; Antisense; GAAACTGAGTCCGAATCTGAAGCTG
>probe:Drosophila_2:1627608_s_at:58:297; Interrogation_Position=56; Antisense; CGAATCTGAAGCTGAATCCGAACCA
>probe:Drosophila_2:1627608_s_at:170:639; Interrogation_Position=96; Antisense; TCTGAATCTGAATCAACCGACACAG

Paste this into a BLAST search page for me
GAATCAACCGACACAGATTCAGATAGATTCAGATACAGGGCCATCAGCAAATGAGCCAACTCGAAGGCAGCCAGCAACAGCATCCAAGCAGCCAAAATCAAATCAACAGCCAAAGCGTCGGCCAAAAGCGTCGGCCAAGTGGCGTTTTATCCAAGTGGCGTTTTATGGCAATTGCTGGCAATTGCGCCATCAGCTGCAAATTGCGCCATCAGCTGCAAAAGCGTAGCACGAGGAAGATGAAAACCATTTCAAGGCAGCCAGCAGAATACGAAACTGAAACTGAGTCCGAATCTGAAGCTGCGAATCTGAAGCTGAATCCGAACCATCTGAATCTGAATCAACCGACACAG

Full Affymetrix probeset data:

Annotations for 1627608_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime