FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627609_at:

>probe:Drosophila_2:1627609_at:694:585; Interrogation_Position=126; Antisense; TGGACAAGCGCATGATGCTGAAACT
>probe:Drosophila_2:1627609_at:147:619; Interrogation_Position=141; Antisense; TGCTGAAACTGAACGGCGGACGCGC
>probe:Drosophila_2:1627609_at:243:243; Interrogation_Position=16; Antisense; AATAGTGACATCTCTAGCTTGCGGT
>probe:Drosophila_2:1627609_at:36:523; Interrogation_Position=166; Antisense; GGTGACCGGTATTTTGCGAGGCTTC
>probe:Drosophila_2:1627609_at:151:71; Interrogation_Position=184; Antisense; AGGCTTCGATCCCTTCATGAACGTG
>probe:Drosophila_2:1627609_at:332:713; Interrogation_Position=197; Antisense; TTCATGAACGTGGTCCTGGACGACA
>probe:Drosophila_2:1627609_at:543:373; Interrogation_Position=247; Antisense; GAAGAACAACATCGGCATGGTGGTT
>probe:Drosophila_2:1627609_at:599:347; Interrogation_Position=261; Antisense; GCATGGTGGTTATCCGCGGCAACAG
>probe:Drosophila_2:1627609_at:5:189; Interrogation_Position=281; Antisense; AACAGCATCGTCATGGTGGAGGCCC
>probe:Drosophila_2:1627609_at:451:39; Interrogation_Position=338; Antisense; ATCTCGTCGAGCATCGTTAGCCGTA
>probe:Drosophila_2:1627609_at:534:41; Interrogation_Position=350; Antisense; ATCGTTAGCCGTAGTGCTTAGTCTT
>probe:Drosophila_2:1627609_at:434:341; Interrogation_Position=365; Antisense; GCTTAGTCTTAAGGCTCCGTAACAT
>probe:Drosophila_2:1627609_at:681:69; Interrogation_Position=376; Antisense; AGGCTCCGTAACATTCATAGTCAGA
>probe:Drosophila_2:1627609_at:439:31; Interrogation_Position=83; Antisense; ATCAAAATGTCGAAGGCCCATCCCC

Paste this into a BLAST search page for me
TGGACAAGCGCATGATGCTGAAACTTGCTGAAACTGAACGGCGGACGCGCAATAGTGACATCTCTAGCTTGCGGTGGTGACCGGTATTTTGCGAGGCTTCAGGCTTCGATCCCTTCATGAACGTGTTCATGAACGTGGTCCTGGACGACAGAAGAACAACATCGGCATGGTGGTTGCATGGTGGTTATCCGCGGCAACAGAACAGCATCGTCATGGTGGAGGCCCATCTCGTCGAGCATCGTTAGCCGTAATCGTTAGCCGTAGTGCTTAGTCTTGCTTAGTCTTAAGGCTCCGTAACATAGGCTCCGTAACATTCATAGTCAGAATCAAAATGTCGAAGGCCCATCCCC

Full Affymetrix probeset data:

Annotations for 1627609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720